GenePrediction:GLEAN_6200 Details

Name: GLEAN_6200
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1654174..1649786 (- strand)
Length: 4389
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1654174..1653891 (- strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_144:1653836..1653343 (- strand)
Length: 494
Type: CDS
Source: GLEAN
Position: GCSC_144:1653280..1652988 (- strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_144:1652929..1649786 (- strand)
Length: 3144
>GLEAN_6200 class=GenePrediction position=GCSC_144:1654174..1649786 (- strand)
ATGGTTGGCGTGCTCAGCTTTTGGCGCCTCGTCGCCGGACTGATAGCTTCATCTGCGGCGGTGATAGTGGCCGACAACGG
CACTTATAGCCTGGCAATAGATTCCTCTAATTCCAGAGGCAGTGAAGGCAACAGAGGGAATGATGGGTCGAGCTGTACCA
AGACTGTGACCGAAATTTGCACGGTAACGGAAACCACGACCACGACCGAGCTATGCACGATTACGGAAACCGCGATCCAG
ACTACTACCGCTTACAGCACGGTCACCACAACCGTTGATCATGTGTAAGTTTGCCTCTCTTTTAACCAGGCCGATGGGAC
GTTGACAGATGATTACAGTTCTGAAGTGACAAAGAGCTACGTCGAGACCGATTACGTGTCAGTCACGTCGACGGACGTTG
AATGGAGCACGGTCACAACCACCGACGTTAAATGGAGCACGACGACAGATGTCGAATGGAACACGACTACAGTCACCGAC
TTTATATTGAGCATAATCACAAGTGTCGACGTAGAATGGAGCAAGACCACGGATGTTATATGGAGCACAGCCACAACCAC
CGACGTCAAATGGAGCACTACGACCGACGTTAGCACGACCACAGACATCAGCACAGCAACTTCCGTCGACGTTGAATGGA
GTACAACTACAGATTTGAGCACAGTGACGTCTGTTGATGTTGTATGGAGCACAACAACGGACTTCAGCACAGCGACTTCT
GTTGACGTCGAATGGAGTACAACGACAGACTCTAGCACAGTAACGTCCATTGACATTGAATGGAGCACAACAACAGACTT
CAGCACAGCAACTTCTGTAGAGGTTGAATGGAGTACGACGACAGACGTCAGCACGACAACTTCCATCGGTTGTTTGAATG
GAGCTCCGCGACAGACTTCATCACGACCACCGACTACAGCACAGTGACGTCCATTGATGTTGAATGGGCCACAACGACAG
ACGTCAGCACAACAACTTCAGTCGAGCACAGCATAACGAGTGTCGTGGATGTTGAATGGAGTACGACGACGGTTGTCTCC
GACATTTTCTCCACAGTCGTTTCAGTCGTTCCCACAACCCTCATATCGGAGATTTTCACTACTGTTGTATCAGATGTCTT
CATCACGGTCACTTCGGATGTTCCTACGACAGTCACATCACACGTCCCCACCACAATTGACGAAACGGTACGCCTCAGTG
TCCCTTCCTGTGAGGGAGAGCATAGCTAACCGGAGCTGCGTATAGTCTACTGTCGTTTCTGTCGACGTTAGCTTAGTCAC
TTCTGATGTGACGATAATCTTCACTACTCCTGTTACAGTCACAGATATCGAGTCGGTTTTCAATACCGAGTCTGCCTCTT
CTGTCACAATCACAAGCATAGACACAGTGTCGGTTACGGACCTTGAGTCGGTGACAGTCACTGACATAGACATCGTCTCA
GCTCCTCCAGTGATTGTCACTGATACGGATATCATAACGGCCTCTCCAGTGACAATTACGGACACAGATGTCATATCAGC
CTCTCCGGTGACAATCACAGACACAGATATCGTGCCGGCTGCTCCAATAACTGTCACTGATACGGATATCATATCGGCCT
CCCCGGTAACACTTACGGACACGGACGTTGTATCAGCCGGTCCGGTGACCATTACAGATACGAACGTCATATCAGCCTCT
CCCGTGACAATTACGGACACTGACACCGTATCTGCCTCTCCTATGACCATTACAGATGTATCGACTTCTCCCGTGACAGT
GACAGACACCGATGTTATATCGGCAACACCAGTCACTCTCACCGACACAGACATCGTATCAGCCTCACCCATTACTATCA
CGGACGTATTAGCTTCTCTAGTGACACTCACAGACACGGACACCGTCTCAGTCTCCCCTATTACTGTCACGGATGTGTCG
ACTTTTCCTGTGACAGTGACAGACACGAATATCATCTCGGCAACACCAGTAACTCGCACCGACACAGACACCGTATCAGT
TCCTCTGGTGACAGTTACAGACACGGCCGTCGTATCAGCCTCTCCAATTACTGTTACGGACGTATCAGCTTCCCCAGTGA
CAATCACAAACACAGACATAGTATCAGCCTCACCCATAACTGTCACGGACACCGAGTCTGCCTCACCCATCACCGTCACC
GGACCTGCATTGCCCGTTACTGTAACGGACATAGACACAGTGACAGATATCAACATTGTGACGGTGCCTCCCGTGACGAC
CACAGCCCCGGGCACAACCGTGACGCTTCCGGCATCGACCGTGACGCTGCCAACGACCACAATCGTGCTGCCAGCTTCAA
CAGTCACACAAGCCGGCTCTGTGACCACATTGCCCGGGAGCGTAGTGACCGTCACCGGGCCCGTGTCCGTGTCGACGGTA
GTGGTGACGTCTGTTCTGCCAGAGTCCACCACAACCATAATAGGGGCTGGCACGACCACCACGTCGGTCATCCCTGCTTC
GACAGTTTTCGCGACGGTCACAAATGTCGTGACAGCACCAGCTGCGACGGTCACTGTTTCTACGACGGTCGTCTCTTCGG
TCAGTGTCTGTCCGGCACCAACCAGTCCAGGCGAGGCTCAGAGCACGTTGGACCCTCGCAGCGACCTCACATGGGGCTGC
AATCCGGGCTACGTATGCAACGCGACGAAACCGGCCGGTTGCAAAGTGTTTTCGGACCCGCCAGAAGACTCGTTCATCTG
CCCTACGGACCAGTGCATCCTCGCACCGAAGCTTCCGGTCGTTCACTGGCCTGCTAACCAAACGTCGTATTACCCGACGA
CGGAGGGATACTTCAACCTTCCGCCACCGGCGTTCGGCCTGAGCTACGACATCTTCTCAGAGGAGGTCATTGTTGAGGTG
ACTGGCGGCGTCACGGTGACAGTGACAACGGGCGACTGGTCGACGCAGTCGACGCTTACGAAGTGGCCAACAACGTCCTC
GTCATCGTCATGGGTGCCGTCTTCGTCGTCGTCGGTGGAGTCGTCATGGCCGTGGACGCCATCCTCGTCATCACGGATAT
CATCTTCATCAGCGTGGACACCGCTGTCGCCGCCGCCATGGTCACCAAAATGGATGACATCGAAAGCAGCCTATACAACC
CACAGTTGGTCCCATTTCAAGCGTGCTATCCCTTCTGATACCCTTCCATCATACTGCTACGATGATTGCAACAATGCCTA
CACGGAGGTTCAGAGCGAAGGAAAGACACAAAAGATGTGTTCCCCTACTTCGGCTTTCATGGAGGACTATGATGCCTGCA
AGACTTGCATAAACGGCGGTTCGAACCAGGCATCCCTGAAGGCCGAAGCGTGGTTGACCGACACATTCTCGCAATTTATC
GACTTCTGCACTTCGAGCCCAGCATCGGCACAGGCTTCCTCGGCTACAGGGCCCCAGAGCGAAGTAGCGACTGCTGCTAC
CGTCCTGACGACGGCACAGGTGGCGGCCACCTCGAGCGCGCCGTCACCGCTCGCGACCCCTAGCACCACCGCAACCACTG
GAGACGGTACTAGTGGCTCTAACGGCGCCACTACGTCTTCCAGCACGGCCTCGGCAACGGCGAGTGCGCCACGGTCAAGC
AGCCCGGTCACATCTTCCGCAGCCGCTTTGTCTTCGGCCACGTCTCCAGATGCTTCCCCCCAAACCTCGCCAACATCTTC
TCTGGCTTCTTCTCCAGCTTCATCCTCCACTGCTACTTCGTCTATTAGTACCGATACCGAAACCGGTGCCAGTGACAGTG
CAGGTGCAATTGCTGGTAGCAGTGCCAATAGTCCAGGGGGCACAGCAGCTACTGTGTTGACGCTCAGCGGTAGCAGCAGC
CTTAGTACGGTTACGACTCGAGGAAGCTCCCCTAACACCGGCACCAGTGTTGGAGCAAGCTCTAGCCCCATCGGTAGCGG
CACTGTTATTGGAGCTGGCACCATCACTGGCACGGCGACTGCAACTGGCACCGGAACCGTGACTGCTGCTGGGACTAGCA
CCGGCACCGGCACTGCTGCCGGAAACACCGTAACTGGGACTGTTACCGACTCCGGCACCGGTAGCATCTCTGCTGGCACC
ACTATTCGCACCACTACTGGCACCGCTACTGGAACTGCCAGTGGCACTTCTAGTGGTCTCACCGGCAGCGCAAGTACCGT
CAGTGGAAGTGGCAGCACCAGCGGCTCTGTGTCATCGACAGCCGGATCGTCAACCGGAAGAACAACGAGGTCTTCCTCGC
TAACGACATCGACATCTTCAACGACTTCGGCCTCTTCTACGGCAACTGGTGGCTCATCAGATGCTATTCCAGCATCTGGA
AAGTCAAGCCCAGGCTTCCATGCCTTCATGGCCTCGGCACCTCTGATTGTATTTTTCTTCCTCGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62