GenePrediction:GLEAN_6208 Details

Name: GLEAN_6208
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1600785..1598637 (- strand)
Length: 2149
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1600785..1600619 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_144:1600495..1600135 (- strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_144:1600073..1598637 (- strand)
Length: 1437
>GLEAN_6208 class=GenePrediction position=GCSC_144:1600785..1598637 (- strand)
ATGGCACGGTCGGCACCATGGCAGCGATGGCCAACCGTCGTCGCTGCCATCGCTGCCGTTTCGTCCGTCTGGATCGGCTC
TGCACGTGCTGACCCTGTCGCGGGCGACTACTTTGTGCACTCGCTTCCAGGCCAGCCAGAGGGGCCGCTGTTGAAGATGC
ATGCTGGGTGAGTGAGGCGGAGCGGCTGTGGACTCGATTGTGGACTCGAAGGCTGGCGAACCAGGGCTAGAACCAAACCA
CCAGACAACAGACAACCAGACAACCGAACTAACCAGTGAATCGCTGCCAGTCACATCGAGATCACGCCCGAGCACAACGG
AAACCTGTTCTTCTGGCATTTCCAGAACAAGCACATTGCCAACCGGCAACGTACCGTCATCTGGCTCAACGGCGGGCCCG
GCTGCAGCTCAGAGGACGGTGCGCTGATGGAGATCGGGCCCTACCGGCTCAAGGATGACCATACGCTGGAGTACAACGAC
GGGGCCTGGAACGAGTTTGCCAACGTCATGTTTGTCGACAACCCCGTCGGCACGGGCTTCAGCTACGTCAACACCGACAG
CTACGTCCACGAGCTGGACGAGATGGCCGACCAGTTTATCGTCTTTCTCGAGAAGTGGTTCGCCCTCTTCCCAGAGTACG
AGCACGATGATGTAAGATACGTCTCGGGGTAGCGTATGCGATCTTGCAGCAGAAGCACTGACAGAATGGCAGCTCTACCT
AGCCGGCGAGTCGTTTGCCGGCCAATACATACCCTACATTGCCAAGCACATTGTCGAACGGAACAAGAACGCGTCGGAAA
CGCACGCCTGGGCGCTGAAGGGCCTGCTGATTGGCAACGGCTGGATTTCCCCCGCCGAGCAGTACGAGTCCTACATCGAC
TTCGCCTACGACAAGAAGCTGGTGACGAAGGGGAGCAGCGATTCCGACAGGTTGGAGAACCAGCGGCGTGTCTGCGACAA
GATGCTGGCAGCGGCTGGCGGCCCGGAGAACCAGCCGGTTGATATCGGGGAGTGCGAAAGCATCCTCCAGGAGCTGCTGA
GAGTCACGCGCCGAAACTCGGGTGACGACAAGGACTGTATCAACATGTACGACGTCCGCCTCCGCGACACATATCCCAGC
TGCGGCATGAACTGGCCGCCCGACCTGCCGAACCTGACCGGCTACCTGCGAAACAACGATGTCATCGCCGCGCTGCACAT
CAATCCGAACAAGAATACCGGATGGCAGGAGTGCAACGGCAATGTCGGTTCGCAGTTTCGCGATCGCGTCTCGAAGCCAT
CCATCGCCATCCTCCCGGGTCTGTTGGCCGAAATGCCGATTGTGCTCTTCTCGGGCGCCGAAGACCTGATTTGCAACCAC
CTGGGAACGGAGGCGATGATCGGCAACATGGCCTGGAACGGCGGCAAGGGCTTTGAGCTCTCGCCAGGCAACTGGGCGCC
GCGGCGCGAATGGACGTTTGAGGGCAAAGACGCCGGCTTCTGGCAGGAGGCCCGCAACCTGACGTACGTCCTGTTCTACA
ACTCGTCGCACATGGTGCCGTTCGACTATCCACGGCGCACGCGAGACATGCTGGATCGCTTTATGGGCGTCGACATCAGC
AGCATTGGCGGAAAGCCGACGGACTCACGCCTCGACGGCGAGCCTGGGCCAACGACCACTGTGGGCGGTGCAGCCGGGAA
CGGCAACAGCACAACCGGCCAGGACGGCGACAAGGCCAAGGTCGACGCGGCCAAGTGGGCGGCTTACCGCAAGAGCGGCG
AGATCGTGCTGGTCATCGTGGCCGCAGCGGCTACCGCCTGGGGCTACTTTGTATGGCGTGATCGTCGCCGCCGGGCCGGC
TATCGGGGAGTGGCCGGCGGCCCTGTCTCGTCGTCCGACACGCATATACCGGAATACAGGCGCCGCAACAGCATGTCCGT
CCAGAGCGGCACTGCCCTGGAAAACTTCCGCAACAAGCGGTCGAACCGGGATCTGGAGGCCGGCGACTTTGACGAGGGCG
AGTTGGACGACCTGCACGTGACCACACCCGCACTGGACTCGCGATACAGCATAGGAGCTGACAGCGAGGACGAGGCCGAG
GGCTCAGACGGGAACACGGAAGCGAGGCGGACAGCTGATCACGAGGGCGGCGTGCAGAAGGCCAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62