GenePrediction:GLEAN_6209 Details

Name: GLEAN_6209
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1596894..1595794 (- strand)
Length: 1101
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1596894..1596858 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_144:1596302..1596261 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_144:1596188..1595794 (- strand)
Length: 395
>GLEAN_6209 class=GenePrediction position=GCSC_144:1596894..1595794 (- strand)
ATGGAGAGTCCAGGTCTTCCCCTATTGCCCTTTCCTCGTAAGATCTCCTTCGTACTCGTATCTTGCACTCGTGAGCTCCC
TGCCATCTTCGTCCGTGCTGTTATAAACAAACTTCTCCCCGTCCTCTTCTCTCTCTCGCTCTTACCTCTTCCATCTTCCC
CCTTCACACCACCTTCTCGGGTCTTCGCCAACTACTACCATCCATCCTTGTGTCTGTGCCGCTTGCCAGTCTGCCAGTCT
GCCATTCTTCCAATCAGTCTCCAGAAACCAATCGTCCACCACACACCTCATAATCGTCTCCCTTGGCTCATCCTGCTTCC
ACCCTCTACGCTTCGCTGCTCTTTGTCCCATATATCTCTCCAATCTAGAGAATCCTCCTAGCTTATAGTCTCGCTTTTTA
TACTTGCTGCAACGCAAACACTGATCGCCATCTTCATCCACCAGTAGCAGGGCCATCCTCGTAAGCTAATCTGCACCGGT
CTCTATCTGAGCGGACTGGCAGCTCCTTTCCCCTTTTGTCTTTCTCTGACCCCCCCTTTCCTCCACTCCAATTCCATAAA
AGGTGGCCAGCCCCTAACTCATCTCTCAACAGCTCTGTCAACATTTCTCTTCTTACCCTCATCAACCATCATTAGTAAGT
GACTGAAAATTCCTAGGATTTGTCCCATGCCCCTTACTATGCAGACTGAAGGCTAATATCTTCCAGTGACTCGATCCCAC
AAGTTCAACGACCGTGTGCACGGTGCCCTTGCCGAGGCTTACGGACCGGAGGACCATCTCCCTAAGTTCTTTGCCAAGAA
TGGGTTTGCCGACACGGACCCGAAGAAGACCAAGAAGAACGGTTGTGGCAAGGGCAACTGGGGCAGTATGGGCGAGGAGG
TTGTTGACGAGAGCTTCAACTTTACCAATGCCCGTCGCCGCTCTAACAGCAGCAACATGGCCACGGACATCAAGAACTTC
AAGACCAAGTTCGATATGAACGAACCGGAGCCGGTTTTTGAGGAAGACATCCATGGGCCTCGCGACGAGGATGAGGAGGA
GCTGCTTCATGCAACAGACACCAACTCGTCGATCGACTCCGAGTATGCCAAAAGCACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62