GenePrediction:GLEAN_620 Details

Name: GLEAN_620
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1026036..1029956 (+ strand)
Length: 3921
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1026036..1026131 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_97:1026203..1026234 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_97:1026303..1026401 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_97:1026473..1026514 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_97:1026572..1026638 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_97:1026706..1026746 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_97:1026800..1027009 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_97:1027086..1027422 (+ strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_97:1027487..1027569 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_97:1027634..1027669 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_97:1028532..1028561 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_97:1028615..1029956 (+ strand)
Length: 1342
>GLEAN_620 class=GenePrediction position=GCSC_97:1026036..1029956 (+ strand)
ATGTCGTCGCCTTCACCGAACCAGGCTGCTTCGTCGCCAGTGGCGCCGCAGACACTTTTGATCGAAGAGGAGTTAGGGGC
TGGAGCGATTGAAGTCGTAAGCTGGGTACCTGTTGTCGTTTATTGGAGACTTGGATAGTCTGGCTGATACGTCTTCCAAT
CCTGTAGGACAACAACGATGGCGACTCTGCCTATGCTCCGTAAGCATTAGTAATATGGCTTCATAGCTTCTCCTTTCAAG
TTGAGTGAAGCAGGCTTACAAAAATAGCACGTTGGTGACCGATACGACCTCTCTCCGGTCCTCGATCATGCATTACAAGT
GGGAGTACGGGCGCCGCTTTCACGCCCTAGACGATGGCACATACTGGTAAGCTATTGGTTGCTACAATCCTTCTATTCAG
GAAGACCCGATATTAAGGATTTTATTGCGGTTCAAAGGGCCGCGAACGACGAAAGACAGCAGAACGCAGAAGATTTAGTG
TAAGTTATAGTTGTCCCCCTTATTCTAAGAAATTTGGTTACTCATTCCTTTCGCAGTCACGAGATGTACCGAAACATTCT
TGATGAGGAATTAACACTAGCCCCGATCCCGGATAACATTCAGGTAAATCTGGACTGCTAGTTTGTATAGAAGAATGCGG
CGGCTAACTGAAAATATCCCTTTTCTCTAGAAAGTCTTAGACATAGGGTGTGGGACAGGAATCTGGGCCATGTAAGAGCT
TCTAGCGGAAGAGATGCCCTGACCCTGACTGACACAATTTATAGTGACTTTGCAGATTTGCATCCATCAGCAGAGGTTAT
TGGCGTAGACCTTTCACCTATACAACCAGCTTGGGTTCCGCCCAATTGCAAGTTCGAAATTGATAATATCAACAGAGATT
GGACCTATGCGAAGAACTCATTTGAGTTTATACACATCCGTGCTATGACGGGATGTGTCCCGAACTGGGTTCAATTTCAC
CGAAAAGCCCTTGAGTAAGAGAGCTATGTGCATGAACAGATGGATTAGAATCTCTCCCTTGGTTGCATATAGTACTGACT
TACAACTCAGGCACCTTGTTCCCGGTGGATGGGTTGAGCAGGTAGAAATATCCTGCCTTGTTCAGAGCGACGACGGCTCC
CTCTTACCGGACGCAGCGCTGGTGCGATGGGGCCAGATTTTTGGACAGGTAGGCGAGAAAATGGGCAACAGCTTCCGGGC
CTGCGAGCTTGCAGCAGATGCGATTAAAGATGCAGGCTTTGTCAATGTCCAAGAACGCCGCATCAAACTCCCCATCGGAA
CCTGGCCTAAAGACGTGAAATTGAAGAGCTGGGGTGCCTGGAACCGGATGTTTTTGCTGCAAGCACTCGAGGGATTTGCC
GTTCGGGGTCTGACGAGTATGTTGGGGGTAAGTGCTGTTCGCGCGCCAAAACATGTGACGTTTTGTTTGGCGCCGTGTTG
ACTTTATTTAGTGGTCAATCGAGGAGGTGCAGCTGTATCTTGTCGAAGTGAGGAAGGAGCTGAACGACCCAAAAATCCAC
TCATACATCGACATGTAAGTCTCATCCGTTATGTCTGAGGTCGAGCTTTATATGCATGCATACTTACAGCACCTAAAGGT
GTGTTGTCATAGGCCAGAAGCCCACAGCTGAGAAGTAAGACGGTAGTGAGAGGACAAGGTAGCTCTGAAAGACAGCAAAA
AAGGTTGATACCGCTTTTAATGAGGAAACCGAAGCATTTTGCTGTTGCCTCACCTAGGTCAGAGAACGTAAGCCATCTTC
GACTGTTCTAGTGTGTTGCAGAGTAATGCCGACTTGGTTACGTAAATGACCGGAAAACGCACAGGACTAAAGATACATCC
CGTCACTATCGTATTTAGAAGCACGACGAGATAGACTTTTCTCCAGGCTTCAATTCCCCGCATGGCCAGTGCTGACCTCC
ACCCGACAGCTATAAAACGGTTAGCGTGGGCTGACTTACAAATGAACTAGTCGCTGTGCTCTGCCTCATTGCCAAGGCCT
TCAGCTGTCGGGCGTACTGGATTGTAGCTAGTGATTCGAGTCCGGGTGCGTTTTACGGATTACAAACGAGTTTGAGACCC
ACACTGTTGCCTAAAACCCACCGCATGAAAGGTGAATGGCCGGAATGGGTGCGAGATAAGACAGTCATTTGATAGAGAGA
AGGCATCCTTGCATGATGGAAGTACCTGGCTCAGATGTTTTCTCGTTGCCTTACGTCGTAACCACACGAGTTGGGCTTCT
TTATAAACAACGCATCCTCAAGCCCAAGCTATTTCTCCCTTTACACTGCTCTCTTTGATGCCAAATTTTGCACTGCTTTC
TCAACTCCAAATATCCGTGGCATCATCCCACCAAAAAGTCACTGAAGATCCCATATACTTATACCAGTTCATTTAAATAT
CGCCCGTTAGTACCGCACACCGAGATTGGTGTAAGAAGTTGTCGCGAAGCCTTTACCGTGTTCTTTTTCCGTCCGCGACA
TACGATCTCTTTTTAGGTCATTGATTGCAACGGTGACCATCGAAATGTAAGTCAAGGCCATTTAGGATTGACCATAAAAT
CCGTATCTGATGACGACAGGATTCGCACTGGCCCGACGACGCCGATCGTGATCGCCCTGATGGGGATCGGTGGAGCTGAA
CGCGAACGCTTTCTGGAGGCCCTTGTCGACACTACCTTGTCGACTTCGTGCACCGAAACTTCAGTGTCCTCGGTGTCCCG
TATCGCTAAAGGAATGATCGATGGGGAGAAAGTATGGCTGGTCGATACCCCTGCGACAGTCTCGGATGACGAGATGGTTG
AAGCAGTGAGAACGGCACTGGGCCACGAACTGCAACAAGAAGACATCACCGTACATGGCCTTATCTGCATCCAAGACATA
AACGAAATATGCATGCACGACACGGCAGAGGAGAATGTCACAGTGTTCAAGAAGCTACTGGCGCCAACTCTCGGGAGCAA
CGTCATGATTGTCACCGCGCTCTGGGATGAACTCAGATCCGCCGTCCAGGGATTCCGCGCCGAGTTCGCGTTGAAGGCCA
TCTACTCTTCGTCATATCCAGCTGTTACCGTGAACCGGGTGGAAGACTCCCGCGATGACGACGTTGGGGATATCTACCTC
GGAATGATTCAAAGCTTGATTGTCAAAATGAAATCCACAGAGGACGACCAAGAGTCTGCGGCGAAGCCTCGGACCAGCCC
AGCTACTTTGCAGCTCCACAGAATCATCGACAAGAAAGACAATGATCTGGCAAGTCTCCGAGCCGAGATTGGCGTCCTGA
AGGACAAGTTTGACGGGCAGTCGGAAGTGCTGTTGAAGCTCTCCCACGAGAAAGAATGCCTGCTGGACAAGCTCGAGCAG
GCCGAGAAGCAGGTCCAGCAGCTGAAGGTGCAGCTGGAGGAGCAAGAGAGCAAGCTCTTCGTCGAGACCAATGTTATGAG
GGAGCAGTTTGATGCCAAGTGGAAAGCCGTGGAAGCCAGGCTTCACGAGTCGGAGAGAGACCGTGACAGCCTCACTCGCC
AGATGGACCTGCTTTCCCTGGACGTTTCTTCACGACAGGAAGAGACAGAAGAGGAACAGGAACAACAGGAGCAGACGCAA
TCGAAGCAGCGAGAGCTCAACCCGAGCCTCAATGTGCTCGACTCTCGCGGCGAGTTCGAGCTCTATCGCGCCGCAGCAGG
TGGACACTACAACCAAGTGAAAGAGCTGCTGGAGCAAGGCGCTGACGCTTGCATGTGCACTAATTTCCAGTGGACGGCAC
TGCACTGGGCGTCCAGCAACGGGCATCCCAAAGTCGTGGAGCTGCTTCTGTCGTACGGCGCCAGCCCGAACGCCACATCG
GACTCGGGACAGAAGCCGCTGGGAATGGCTAGGACAGACGAGATTCGAGAGATTCTGCTGAAGTATGGGGCTACAGAGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62