GenePrediction:GLEAN_6210 Details

Name: GLEAN_6210
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1583529..1580354 (- strand)
Length: 3176
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1583529..1583324 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_144:1583267..1583020 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_144:1582770..1580354 (- strand)
Length: 2417
>GLEAN_6210 class=GenePrediction position=GCSC_144:1583529..1580354 (- strand)
ATGGAGCGCAAGTCGAGAAAACCAGCACCGCCCGCGGCCTCGGCCGCTTCGACGGCTCGCAAGCCAGCAGTGCTCTCTGA
GCGCATCAACACTGCAATCAACGGCCTCATCCGCCACTTCGTGCCCGAGGATCCGAACGAAGATGAGGCCACAGCACAGA
GACGGCAGGAGTACTGCTTCCACCTTGTGCGATCCACTCTGGAGACGTATGAACCCTCCCTCTGTCTCTCCCTGGTGCAG
CCACCCGAACTGACAACGGCAGGTCCATGTCTTCTGACCTGGCCACGGATGTCAACCACACGATGGACCTGATCCGCAAG
AAGCTGACGGTCGACCGGCCTAACGATGCGTGGCGGTTCTCACAGCTGTACTCGCGGCTGCTGGCGCTGCCCGTGCTCAA
CCAGAAGTGGGCCATCCTGTATATGCTCTATCAGCTGGCCGACTCGACCGGAACCAGCGATCCGATGCGACCGCTCCTGC
GCCTGAACGAAGAGCAGGCTGCTGCCGAGAGTGCTGCTGCTGCGTCGGGAAGGACAGCTCGAAACCCCCTACCTCCAACA
CAGCAGCAGCAGCAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAAACTCA
GCCACAGCCTCACGCCCAGCCTCAGCCTCAGCTTCAATTCCAATCACCATCGCAACTACAGGTGCAGTCACGGACGCAGT
CACGGACACAGTCACAGTCACGGTCACAATCACGAACAGCACGGCCGCTGTCCTCGCTCGGTCCTCGATTAGAGCAGGAG
GTGTTTGACGATGCCTTTGCGCGAGGTGGTCTCAAGCGCTTCCCGCCTGACAAGGCACGTCGGGGCCCGGAAGAGGCAGC
AGCTGCCGCTGAGATCGACCCGGCTGTCATGCTCGGCCCAGCCGCACGGGATGTTGCGCTCAAGTCGACGCTGCTTGCCG
ACAGTCCGGCGACGACAGAGCCGAGCGAGACCACGCTGCTGCGCGACCTGCCGTTTACGTTGCAGGGCCTGGACTCGGCC
ACGATGGTCTTCCGCAAGGAGGTCCGCCGGGAGGGTCGCAAAGAGAACAGCAAGGAGGTGGCGGTACTAGTGCTTCCGGC
GACTCTGCCGGTGCCGATCGTGTCGCTGCTGCACACGTTGGCAGAGCCGGCGCTGCTGTACCGCGGGCTGGACGAGTTTG
TGCGGTCGCCGGCCAAAGGACTGCTGGGACAGAGCCTGCGCGCAGCCATCAGCACCGAGCTGCGGGCATATCTCGGCCTC
GTGGCCACGCTGGAGAGCCAGATCCGACGGGCATTGGCCACGCTGGACACAGCAGCCCCGCGTAGTGGGATCGGACGGGC
CGGTGTGACGCTCAAGCGCTGTGTGGTGTGGACACGAGAGGCGACGATGGGGCTGCGGCTGATGTCGCTCATTGCCGAGG
AGTCGGGCAGCAAGCGAGGCGGACAGCTGATCTCGCTGATTCACCGGTTCTCGACGTCGCACGGCGACCCGACCGTAGGC
GCGTTTGCCGAACGGCTGCTGGGGCCGGTGGCGCGACCGTTTTATAACATCCTACGACGGTGGATCTATGACGGCGAGCT
AGCCGATCCATATCGCGAGTTCTTTGTGCGCGAGCAAGGGACCGGGGCCGAAGACGCAAAGCGACAGGAGGCAGCACGCG
CCAAAGGTCACAGCTCGGTGTGGAACGACAAGTATGAGATTGACGCGGCCATGATCCCGTCCATTATGGCGGCTGAGTTT
GCTGAAAAGGTGTTTCTGATCGGCAAGTCACTCAATTTCCTGCGTCATAGCTGCGGCGACGCCCAGTGGGTCGACGACTA
CAGCAAGGGTGCATCCAAGGAGCTGCGGTATGGCGATACGGCCACGCTGGAGGCCTGGATCGACGAGGCATACAAGACGA
CGATGCGTCGGCTGATGCAGCTGCTGACCGACAAGTTCCGACTGTTCGACCACCTGGCCGCGCTGAAAAAATACGTGCTG
CTGGGCCAAGGCGACTTCGTAGCCCTTCTGATGGAATCGCTGGCGCCCAACCTCGACCGTCCGGCCACGGCCCAATACCG
TCACACGCTGACGTCGCAGCTGGACCACGCCATCCAGGGCTCCAACGCGCGCTTCGAGCCGATCGAGATTCTGCGCCGTC
TGGACGCCCGCATGCTGCAACAATCGCACGGCGACACTGGCTGGGACTGCTTCACGCTCGAGTACAAGATTGGCGCCCCT
GTCGACTGTGTCGTTACCGAGTGGGCCAGCAAGCAGTACCTCAAGGTCTTCAACTTCTTGTGGCACGTCAAGCGCGTCGA
GTTCGCCCTGGCGTCCACCTGGCACAAGTGCATGACCGGTGCTCGTGGCGTGCTGCAGACCGACGACGAGGCCGTGCACC
AGACCTGGAAGACCACGCGCGGTACCCTGGCCGAGATGGTCCACTTGGTCGGCCAGCTGCAGTACTACATCCTGTTCGAG
GTCATCGAGGCCAGCTGGGAGGCCCTGCAGGCTGCCATTCGCCGCGACGACTGCACTTTGGACGATCTCATCACCGCCCA
CACCGCCTACCTGACTTCCATCACCCACAAAGGTCTGCTGGGCGTGCGGCGTCGCGCCTATGTGGAGATGAAGCAGCAGC
AGCAGCAGCAGGCCACCATGGCCGCCGCCGCAGCCGCAGCTGCTGGTGCTGGCGAATCTGCTTCGTCTGCTCTCCCACCC
TCGGCCGCCGATCCGTCCGCCGAGGATGCCAACGGCTTTCCCTCGCAGCTCAAGGAGCTGCTGCGCACCATGTTGGCCTT
TCGCGATGCCGTCGACGGCCTTTACAGCTGGGCTGTCTCCGACTTTACGCGCCGCCAGGAGGCCGACGTACTTCGTCACC
GTCAGACGCCGGCGAGCGCGCGCATCAACGCCAACATCAACATGAACACCAGCCATGGCGATGATTGGGATGACCCGACG
CCACCCGTGCCGCCGGCGCCCACTGTCGAGTCTGAGCTGCCCGCCCTGCAGCAGCGGTTGCTGTCGCTGTCCAAGACGTT
CCGCAAGCGCGTCATCTATCTGCTGGCCGACTTAGGATACCAAAAGGACGCCGACCTGCGCTTCCTCGGCGTGGCCATGA
ACTTCAACGATGTGTATGTGGTGCCGCAGGGGAAGCGGCATCAGCCGAAGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62