GenePrediction:GLEAN_6211 Details

Name: GLEAN_6211
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1566877..1566041 (- strand)
Length: 837
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1566877..1566727 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_144:1566654..1566041 (- strand)
Length: 614
>GLEAN_6211 class=GenePrediction position=GCSC_144:1566877..1566041 (- strand)
ATGTCTTCTCGAGACATAGACAGAGGCAGCGGTGATGCGGAATTTCGCGTCAAGAGCGAGTCTCTTGAGCCGCCTGCACT
GTCAGATCTAGCTGTTCCTGTGCGGAAGCCTAAGAAGCCGAGACATGCCACAGTCTACGATGCCGTCGCCGGTAGGCATG
GACAAATACTTACCATTTCTGCGGTAGAGTTTCTAATCTGACATAGCGACCATTTTCTAATAGGGAAATATTCTATGTTC
AAAAAGCGTGTACCGGTTACAAGCACCCATGATTTCATTCTTGCTCCAGAGGATGTGCTATTTCAGCACCCCGACGCACC
AACACGCTATCACGAAAAAGACATATACTTTACGAATGAAGACCTTCCGAATGCCGGCGAGGGTTTAATACCGAACAGCG
AGCTGCTAGACGAGGTGCATACGTATACGAGCCGTTTCTACGAGGCACTGGCAATACGGGCAGAGCAAAGGTTAGACCGG
ACGCAGACCGGCATTGTCAATGCCAGGCTGCTAGACGAGCGCAGCATGGACGAGACGGCTTTGATTGCCTTTGGCATTTT
GCTGGAAGAGGCAGGCCGACACATCTTAGGAGCGCGCGGCGATCTCGTCTTTACGGAAGCAGACGACGAAGATGATGACG
AGTCCGAGGAGACAGAAGGGGGAGGCGAGGGGGAAGAGGCGGAATCGGTACACACGACAGGCAGATCGGTCGACTCAAAA
GAGCCAAAAAGTGCAGATTCAGAGGAGGAGGAGAGAGAACAGGCTCAGAAGAAACAGCGGTTGAAGCGCCGAAAGTTGTC
TGGTAGACGCCAGACACTTGGCAGCGATGATGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62