GenePrediction:GLEAN_6212 Details

Name: GLEAN_6212
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1557419..1552801 (- strand)
Length: 4619
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1557419..1556146 (- strand)
Length: 1274
Type: CDS
Source: GLEAN
Position: GCSC_144:1556083..1554479 (- strand)
Length: 1605
Type: CDS
Source: GLEAN
Position: GCSC_144:1554403..1554326 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_144:1554246..1553662 (- strand)
Length: 585
Type: CDS
Source: GLEAN
Position: GCSC_144:1553593..1552801 (- strand)
Length: 793
>GLEAN_6212 class=GenePrediction position=GCSC_144:1557419..1552801 (- strand)
ATGGACCAAGGTCCAGAGAGCAAGAAACCCCGTCTCTCGACTGGATCATGGTCCACAGGAACACCTGCCGCCGCTCACCT
CCACCACGCTTCTTTCCCCAACCCTAATCCCGGTACTGCCTCGCCTCAGGCACCGCACCCCACGCCATCGGGTCCATATC
AACCCTCCCATCCCTTCTCTCGTTCCTCTGACCCCCCTCCCGTCTCCTCTCCTGCTCCTCCGACACCTAATGCTGCTCAC
TCTTACCCTCACCTACCCCCGCCGCAGTCGACGCCGCAGCCACATCAGTCGCGCGCCACCCATCCGTCTGCTCCTCCCCA
CCAGCAGCACTACGCCGACGACCGCCGATATCATGAGCCAGACCAGCACACATCTATGCAGGACCATCGACAGGACTACC
GTTCCGACCACCGCTCGGAGTACCGACAGGATCATCGGCCTGAGTACCACCAGGACCAGCGACTAGACTACAGACAAGAG
TACCGCCACCCGGCCCCCTCGCCTGCTCGCTTGTCTCCTCCCTACGGCACTTCCTATGGACGCGAGCAGTCCTTGAACGA
AGACGGCCTGCCTCTGATGCGCCGGCTCGACTCTGGCTCGATTCATGCATCCCAGCAGCAGCAGCAGCAGCAGCAACCGC
CACCACCACCACCGACTTTGCTACACCCCCAGCACCCTCAGCATCCTCAGCATCCTCAGCATCCCCAGCATCCACCGCAC
CCGCAGCACCATATTGATGACAGCCGGCGTCAGATGGGCTTTGATAACATCGCCCACCCCTCAGCGTCGAGCCCGCACCA
GCTCCCTCATGCGCAGCCGCCTCTGCCGCACCAGCTGCCAAACCACCAGCCAGTCCAGAGCCCGGGCCACAGCCACCAGC
CGCCACCCCTTCATCCGTCGCACTCGCATGGTCACTCTGCAGTACCGTCAGCTCAGTCCCAGGCTCCGCCTCCTCCGCTG
CCACCACCGCCCCCACCACCGGGCGGGCCTTCGGTATCAAACATGTACCGGCCACAAAGCAGCTACCCGCCAACTCCTAC
AGCTCTGAGCCAGTTTGACCCCCCCATCTTTGGCCACTCTCAGCCATCCGCACAGGGCCCGGACCAGTCCTACCCCGTCT
CCTACTCGGGAACGGGGAAGAAGAAGGCCCAACGCGCTTCGCAGGCGTGTGATAGCTGCCGGTCATTGAAGGCCAAGTGC
GACGAGACCAAGCCTTGCAAGAATTGCAGGGAAAAGAATATCGAGTGCAAATACCGAGATCCGATCCCGAAACAGTAAGT
AATACTTTGTGCTTGGAAGCAGTATAGACGTTGTTTCTAAAACATGTATACTTTAGGCAAGACAAGGTGACCATCGACAT
TATGGAAGCCATCAACAGCCTGGACCACACACTCCGTGGCGAGATACGAGAAGTCCGCGGGGAGTGCAAGGCGATTGTTA
GCAGCGTCCAACAAATGTTGGCTGAAGTGCAAAACACAATCAAGTTAGGCATTATGAACTCCGATCGTATTAGTCAGACC
GGGGCGGCGTTGAATGCGACATCTATGGTGAACTCGCCGCGTTCTGATAACGATAATAAGAATACATCTTCGCCGAAGCA
ACCTTCACACTGGTCGAGAAACATGGGGCTGGCCCCAGAAGAGGCACAGAGGATATCGGAGCAGCTGCAAAACGACGATC
ACATGGATGTGGTCCCTGGCCCTGCTGTGCCGCCCGGAGAACCGGCCATTCCTGCATATCACACTACATTGGCCAGTCTG
CTTCTAACCTGGCCCACGATCCGCGAAAGGGTAGAGAGCCATCTAGAGGCGGCTGGCATCCGCTTTCCGTCCGAGTTCCC
GGTGCGCCAGGAGCAGCGAAGAGGTGCCATCTCTTTCTATGGGCGTGGCGAGGACTCTGCGGGCGACAAGGGCCGCGGCG
AGCTAAGCATGGATCCGAATGATGTACTGCACATCGAGGGCTCGCAGACGGTTCCTGTTGCACCGGCACCGAATGTGCCT
GGCAGCAACAGGAGCAGCCCGCAAAACCCAGACAACCTAGACACGTTTAACAACGCACAGGAGTCGTCTGAATCAGCGCG
CGATTCGTGGAACCCGCCTGGAGGCCTCAACTCGCCTAGCCCGGTAGAAGCGGTCAAGGGCCCGCCAACGCGAGTTGCCA
TCGAGCTGGATCTAAACCCGGATAAGGTATGGGACTATGTTCGCAGCTACGAGAAGAACATGCAGAACATACACCCGCTG
ATCCCGCCGCTGGATTTGCATGTAATGACGACGATGTTCTTGCAGAATGCAGCCAAGTCGTCGGGCTCGCAGGCGGCAAA
GCCGTGGGCTCCTGTGGCGGAATTTGCAGGCGGGTCGAGCTCGCCAGTGGTGGAGGGCAACCTAAAGCGGAAGCGGTCTC
CGGTATCGTCCGGCGAGGGGACCGTTCCTCAGCGACAGACGCCCCCAAGACCAGGACCGCGTTTCCAAGACGTCGACAGC
ATGCTCGTTCTTATGGTGCTGGCACTGGGCAAGGTCTGTCTTCATAAGCATTCGAAGCTTCCGGATGTCGTTCCCGACAA
TGACGACGAGGCTGTATCGTCACAGTCGCCACAGCCGCAGAACGGGTACTCACCGTCTCTGGTGCACGATTCTCCGATGT
CGGTGCCGCAGGGCGGCAGCCGCAACGTGCCCAGTCGCCGCTCGTCCTTGCAGGGTGGCCAGGCGCAGTATCCAGCGTCG
CGACCATACTCGATGAAGCGGAACGTGGACAACATTCCGGGATTCGACTACTTTGTCGAGGCCTGTGATCGGGTTGGCAG
CCACGTTGGCGGACGGCCGCAGCTGAAGCTCGTGTGGGTATACATCATGATGTGCTTGTACTACAGCCAGCTAGGCCGGC
CGATGCAAAGCCTAGAGTTTGTCGTGTTCGCTGGCCGCCAGCTGCAGATTCTTCTCCGACCGTGAGTATAATTTGCGTAG
AAAGTCTTTACAATGGTATATAATACTGTGTGCTAACTTAAAGCTACTCGTCGCAGACTGTTTCACAAATTTGGGCAGAT
GAAGATTACGGTGCCTAAAACGATTCACAGGAGGGAAAACCAAATGCTATTCGCGTTCTGGACCTGTCTGCAGCTCGAAA
GGTTTGCTTCCCGGTTCCTTTTTGCCTGAGGACGGCATCTAACGTGAACATAGCGACCTTTTGGCGGAACTGCCGCTTCC
CCAATCGGGTATCCTAGCGTACGAACAGCAGATGCCGTATCCGTTTCCTGACAGCTCCTCGCCGGGCGGTTTCGAACCAT
ATGTTCTAGAGAGCTACATGGCGCAGCTATTTCTTCGAAACCAGCTGAACGATATCCATAAGAACCTGTACGACGGACGA
CAGGACCCGAATCTGATCAACAAAGGCCAAATCATCATCTTCACCGAAGCTCTGGACAAGTCGTTGTGGGTGCCATCACA
GTTTAAATTCCAAGACGAGGACCCACCGGCCAACGAGATCCTGGCAGCACGGCTGCGAGCAAAGTACTGGGGCGCGCAGG
TGATCATTCACCGGTTCTTCATTCGGCGAATTCTCGACTACAACTACGCGCAGCGGATACGGGCACAGAACAGGGGTGGC
GCAGCACTGGAAGGACAACCGACGGAGAGTCCACTGACATCGGAAAACATTCAGCTGGCGCGACGGGGTGTGCAGGCGTT
GGTAGAGAGCACGCGCGCGTTTCACGGGCTTCCCGACAAGCGTTACGTGGTGACCAACGTGTTTGGAACGGCGCATGCGT
GAGTGAAGCCGGAAAGCCGAACGCGTTTGAGTGCTGATAACTAACTTTCCACTCTTTTTCAAACAGGCAATGGGGAAATC
TCCTTGTGCTGGACTCCGTCCAAAGGGACCCGGTCCTCGGCCAATTCATCGAAGAGGAGTTCCTCAACGAGCTGTTCACC
AAGACGATTGACTTTTTCGGGGTGATCGCACAGCCCAAGAGCGCGCTCGCCTACGACATGCGCATCCTCAAAGGCCTGCT
GCAGGACCGCCAGCTTCATCCCCAGCGACATCCACGGGCCGAAACCATGGCCTCTCCGGCCACACCGGCGCCGCCGCCGT
TTGCGCCGTCGTTCTCGGCAAACCCGTCTCCATCGACGGTGCCGGCATCCCTTCCGCCATCGGTGCAGGCCATGAGGACT
GATTACCCATATTCCTCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAACAACAGCAACAACAGCAACAACA
ACAGCAACATATCCCGATGCCACACACGCACAGTCAATCGTCCTCCACGTCAACAGGCAGCTTTCCGGGAGGTCACAGCC
CGCAGCCACCACCACAGGTGTTGTATGGCCAGCCGCTGCCTCGCATCCAGGGCTCGCCAATGCAGATGTCCCCCGGCAAC
ACGCCGCCGCTGTTTGCGCCGTCCACGCAAGGTCCCTCGCCTCCGGGCCCGGGCTTGATGCATGCCCCCCCGCCGATGCA
GAGTCCGGTGCAGAGCTCGCTTTACCCGCCACAGGTGGCCACGCCGTCGGTCAAGGGGCCGAGCACGCCGAGCGAGTCAG
GCTTCCCGCACCACTTGCCTCCCTACGAGCAGCAGAGGCAGTTCAGAGACAGCGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62