GenePrediction:GLEAN_6213 Details

Name: GLEAN_6213
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1534297..1532943 (- strand)
Length: 1355
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1534297..1534112 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_144:1534042..1533952 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_144:1533880..1532943 (- strand)
Length: 938
>GLEAN_6213 class=GenePrediction position=GCSC_144:1534297..1532943 (- strand)
ATGAAGCCCATCATCGCAGTGCCGGCCACGCTGGCGCTGCTGTATCGCAGCTACAGCAAGAAAAGCCTCACGCCGGCCGG
CATCGTGGCGGCCCTCCTGACGGCTGTCGCTCACGCGGTTCATCCATGGAATCTGCCTTTTGTGCTGCTGGGCGTCTTCT
TCCTGGCCGGCACTAGGGCTACACATGTGAGCAGCTGCTGGGAGCGTGTGCCCCGCTCGCGTAGTCTCCTCGTGCGCACC
TGCTGACGGACACAGGTCAAGGAGAAGGTCAAGGCGAAGCTGACGCTTCCGGCCGACGGACCTTCGACCGGTGGTGGCGG
CGAGGGACCGAGGACACACACGCAAGGTGAGAGTGGCTGGCCGGTCGGCTGTTTCGGACGCACCGTCCTCCTCCGCCGTC
CTGTACTGACGACGCAGTGTTTGCCAACTCGTTCGTGGCGTCGGTCCTGTCGCTCATGCACGCCTACCAGCTGCACCAGC
GAAAGAAGGCGATTGTGGGGCTTCGCGATGCGGGCAGCCCAGCCGATGCAGCCCTGGGGGCGCTCTGCTACGCGTGGGGC
GGCGATCTGCTGGTGATCGGCATCATCGCCAACTATGCCTGCGTCGCTGCCGACACCTTCTCGAGCGAGCTGGGCATCCT
CTCGGGCGAGACGCCGCGGCTGATCACGTCGCTGCGACTGCGCAAGGTGCCGCGCGGCACCAACGGCGGCGTCACGCTCG
GCGGCCTGGCCGCGGGACTGCTGGGCTCGACCGTGGTGGTGACGACGGCCGTGCTCTTCCTGCCGGCCTGTGCGGCCGAC
ATGCACCCGATCCTCTTTGGCGGGATGGCGGCCACGACGGCCACCAGGGACGCGGCCGTCTGGACCATCGGCGAGCGCCG
GTTGCTGATGCTCGGCCTGGCTGTCTGGGGACTCCTCGGCAGCGTCCTGGACTCGGTGCTCGGCGGCCTGCTGCAGCGGT
CGGTGCGCGACGTGCGGTCCGGCAAGATCGTCGAGGGCAGCGGCGGCCTGCGCGTGCTCGTGGAGGAGCAGCCGCATGTT
CACCTGCATGGTCCGCTCGTCGATCCAGACTCTCCGGCCGCGGCTGTCTCGGAGGATGAGGCCGACCCGACCGACGAGGC
CATGGACGCGAAGAAGGCGGCTGCAGTGCCGATTCCGGACCGATACGACGTCCACATCAAGCACCGGCGGCCGAGCTTTG
GCAACTATAGGCCTAGCCGGGTGGTCGAGAATGGCTGGGACCTGCTGGACAACAATGACGTCAACTTCCTGATGGCCTGC
ACCATGAGCGTGGGCGCCATGTATGTTGCCGGCTGGTACTGGGGGGTGCCGATGCAGTCGGTACTGAGGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62