GenePrediction:GLEAN_6217 Details

Name: GLEAN_6217
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1472505..1471541 (- strand)
Length: 965
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1472505..1472339 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_144:1472273..1471541 (- strand)
Length: 733
>GLEAN_6217 class=GenePrediction position=GCSC_144:1472505..1471541 (- strand)
ATGGCCGCTCAAACATCCCCCGCGGCAGCCTCACGGAGGCTTTTTGCTCCGCTTAAGGGCTACACAGCTCAGGGCCGGCC
GTCTGCACCCGCCCCGGCTCCTGGCCAGCAGAAGCACCGCCCGCGAGTCCTGAAGGGTGTGGTGTTCGATGTTGACGGCA
CTCTCTGGTGAGTCACGTCGACCATGCCTCCCACACGAACAGCTTAGGCTCTGACGGCCTTTTCGGACTCAGCATTCCCC
AGAACTACATGTTTGGCGAGATGCGTGCGGTCCTCGGCATCGACAAGTCCATAGACATTCTTGACCACATCTACTCCTTG
CCCACTGAGGACCAGCAAAAGGAGGCCATGGAACGAGTGCGAGTCGTTGAGCGCCGTGCCATGGCCCTGCAGCAGGCCCA
ACCAGGCCTGCCAGAGCTCATGGCTTACCTGGATTCGCGCGGTATCCCCAAGGCCATCTGCACCCGCAACTTTGAGCAGC
CCGTGAAACATCTGCTGGGAAAGTTCCTTGACGGCCACACTTTCGAGCCCATTGTCACGCGCGACTTTCGCCCGCCCAAG
CCCGATCCTGCAGGCATCCTTCATATCGCCCGCAGCTGGGGACTGACACGCTCTGGAGCAGCTGAGGACGCCGCATCCCG
CGTCTCGGACGAGGACACGGTCGATCCCGCCGTCCTTCTGGCTGAGAAAAAGGAGGAGGCCATCGAGCAGGCCGCGTCCG
CTTCTGCGCCTACGGCAGCAGTTCTTGAGGCCGATGCCTCCAGTCTCATCATGGTCGGCGACTCCATCGACGACATGACG
GCGGGACGCAGAGCCGGCGCAGCAACAGTTCTGTTGGTAAACGACGTAAACCGACATCTGGCTGAGCATGCTCACACAGA
TATGGTGATCGCACGCCTGGACGATCTCATCGATGTGCTCGAGAAAGGCTTCGTCGGCCGGGAAATGTCACACCTTGAAT
CATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62