GenePrediction:GLEAN_6218 Details

Name: GLEAN_6218
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1466011..1465348 (- strand)
Length: 664
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1466011..1465970 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_144:1465896..1465832 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_144:1465756..1465532 (- strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_144:1465471..1465348 (- strand)
Length: 124
>GLEAN_6218 class=GenePrediction position=GCSC_144:1466011..1465348 (- strand)
ATGTCTACAGCGGCTCGTCGCCGTCTCATGCGCGACTTCAAGGTTCGTGGACATGGCGGCTCGGGACCACCGCTGTTTGT
TGCATTCCCAGACTGACAGGCGTCCGATACCATAGCGCATGCAGACTGATCCACCGGCCGGTGTCTCCGCTTCGCCTATC
CCAGACAATGTCATGACCTGGTCAGTCCCAAGAACGGCTCGACTAGGGTTTGACTTCTTAGCCGGTTGGTACACTGACAG
CTGACGCCGATATAGGAATGCCGTTATCATTGGTCCTGGCGATACGCCCTTTGAAGACGGAACCTTCCGCCTGGTCATGA
CGTTTGACGAACAGTACCCGAACAAGCCGCCCTCGGTCAAGTTTCTGAGTACAATGTTCCACCCGAACGTGTACGGCTCC
GGCGAGCTCTGTCTAGACATCCTGCAAAATCGGTGGAGCCCGACTTACGACGTGGCTGCCGTACTGACCAGCATTCAGAG
GTACGTAACCGTTGCCCGTCTTCACTTTCGCTGTTACAGCGCTCTAACGTGCCGTTGCAGTCTTCTGAACGATCCAAACA
CCAGCTCGCCGGCCAACGTGGAGGCGTCGAACCTGTACAAGGACAACCGCAAAGAGTATCACAAGAGAGTGCGCGAGACG
GTGGAGAAGAGCTGGGACGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62