GenePrediction:GLEAN_6219 Details

Name: GLEAN_6219
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1464281..1461166 (- strand)
Length: 3116
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1464281..1464162 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_144:1464098..1461568 (- strand)
Length: 2531
Type: CDS
Source: GLEAN
Position: GCSC_144:1461400..1461166 (- strand)
Length: 235
>GLEAN_6219 class=GenePrediction position=GCSC_144:1464281..1461166 (- strand)
ATGTCTGCCGCGAACAGCATCAAGGTCGTGGCCCGGTTTCGGCCACAGAACCGGGTGGAGAACGAGTCCGGTGGCCAGCC
CATTGTGCGATTCAACGGCGATGACACCTGTACCATTGACGTATGTCGTGTTTCCCGGGAGTCGCCGTCCGCTGCAAAAG
GCCAGAAAAACTAATGTGAGCAGACGAAAGAGGCCCAGGGGTCCTTCACGTTCGACCGGGTGTTCGACATGTCCTGCAAG
CAGTCGGACATCTTCGACTACTCGATCAAGCCGACGGTGGACGACATCCTGAACGGCTACAACGGCACGGTGTTTGCCTA
TGGGCAGACCGGTGCGGGCAAGTCCTACACGATGATGGGCACCAGCATAGACGACGGTGAGGGCCGCGGTGTGATTCCCC
GCATTGTGGAGCAGATTTTTGCTAGCATCCTGGCCAGCCCGGCTACGATCGAGTATACGGTCCGGGTGAGCTACATGGAG
ATCTACATGGAGCGGATCCGCGACCTGATGGCGCCGCAGAACGACAATCTGCCGGTGCACGAGGAGAAGAACCGGGGCGT
GTACGTCAAGGGTCTGCTGGAGATTTACGTGTCGAGCGTGCAGGAGGTGTACGAGGTGATGCGGCGGGGTGGCAACGCGC
GAGCGGTGGCGGCCACCAACATGAACCAGGAATCGTCGCGGTCGCACTCGATCTTCGTGATCACCATCACGCAGAAGAAC
GTCGAGACAGGCTCGGCCAAGAGCGGGCAACTCTTCCTCGTCGACCTGGCAGGTTCCGAAAAGGTCGGCAAGACGGGTGC
CAGCGGCCAGACGCTGGAGGAGGCCAAGAAGATCAACAAGAGTCTGAGCGCGCTCGGCATGGTGATCAACGCGCTGACAG
ACGGCAAGTCGTCGCACGTGCCGTACCGCGACTCGAAGCTCACGCGGATTCTACAGGAGTCTCTAGGAGGCAACAGCCGA
ACGACGCTGATCATCAACTGCTCGCCCAGCTCGTACAACGACACAGAGACGCTCAGCACGCTGCGGTTCGGCATGCGGGC
CAAGTCGATCAAGAACAAGGCCAAGGTCAACGCAGAGCTCAGCCCGGCCGAGCTCAAGATGCTCCTGGGCAAGGCGCGGA
CGCAGATCACGTCGTTTGAGAGCTATGTGTCCAACCTGGAGAACGAGGTGCAGCTGTGGCGGTCGGGCGAGGCGGTGCCG
CAGACGAAATGGGTACCGGCGCGGGACGGCAGCAGTGTGGTGACGCCGCGAAACTCGATGGTGGTAGCGGCTGCGGCTGC
ATCTGCGGCGTCACCACGGCCGTCGACACCATCGCGACTCATTCCGGAGGGACGGGCGGAGACGCCGGGGATCTCGGAAC
GGGCAGGCACGCCGTCGCTGCCGATGGACAAGGACGAGCGGGAAGAGTTTCTGCGGCGCGAGAACGAGCTCCAGGACCAG
ATCGCGGACAAGGAGAACCAGGTGGAGGCGTCGGAGAAGCAGCTGCGCGAGGCCAAGGAAGAGCTGCTGATGGTCAAGGA
GCACGACGGCAAGCTGGGCAAGGACAACGAGCGGCTGACGAGCGAGACGAACGAGATCCGGATGCAGCTGGAGCGGCTCT
CGTTTGAGGGCAAGGAGACGCAGATCACCATGGACGCGCTGAAGGAGGCCAACGCAGAGCTGACGGTGGAGCTGGACGAG
CTGAAGCAGCAGCTGTTGGACGTGAAGATGAGCGCAAAGGAGACGAACGCGGTCCTGGACGAGAAGGAGAAGCGCAAGGC
GGAGAAGATGGCGGAGATGATGGCGGGCTTTGACCTGGGATCGGACGTGTTCAGCGACAACGAGAAGGCGATTGCGGACG
CGATCGAGAACCTTGACGTGCTGCACCAGCTGAGCAGCGAGGGCGACGTGATCCCGCCAGACGACCTGCGGGCGCTGCGG
ACGAAGCTGGTGGAGACGCAGGGGATCGTGCGGCAGGCGGAGCTGGCGGCCTTCAGCGCGCAGTCGAGCGAGTCGGAGTC
GCGGCGGCGGGCGGAGCTGGAGCTGCGGCTGGAGGCGCTGCAGCAGGAGTACGACGACCTGGTGACGCGCAACCTGGGAC
CGGAGGATGCGGGCGAGCTGCGGGCGCGGCTGGAGAAGTCGCTGACGGACCGACAGACAGCCCAGGCCGAGCTGATGGAA
GAGTTGCGGTCGGATGTCAACCGGAAGGCGAGCGAGAACGAGCGGATGAAGGTGGTGATTGAGGATCTGCAGCGACAGCT
CAAGGCGGGCGCCGTGGCGAGCGGCAGTGTCGGTGTTGGTGGCAGCGGCAGCAACGGCAGCAACAGCAGTGGTGGTGTCG
GCAGCGCGGCAGCACAGGCAGCCTTGGCCAACGGCAAGACGGTGGCGCAGCAGATGGCCGAGTTTGACGCGATGAAGAAA
AGCCTGATGCGCGACCTGCAGAACCGATGCGAGCGGGTGGTGGAGCTGGAGATCTCGCTCGACGAGACGCGCGAGCAGTA
CAACAACGTGCTGCGGTCGAGCAACAACCGGGCACAGCAGAAGAAGATGGCCTTCCTGGAGCGCAACCTGGAGCAGCTGA
CCCATGTGCAGCGACAGCTGGTCGAGCAGAACTCGGCGCTGAAGAAGGAGGTGGCCATTGCGGAGCGCAAGCTGATTGCG
CGCAACGAGCGCATCCAGAGCCTCGAGAGCCTGTTGCAGGACAGCCAGGAGAAGATGGCCCAGGCAAACCACAAGTCTGT
TTTCCCTTTTTTTGTGTTTTTGTTTTTTTGCTTGTTTTCCTTCTTGTTTTCCTTGTCCATCTCCTTGTCCTTGTCCTTGT
TTTTCTCCTCGTCTGTCTTTCTCGTCTTCTCCGTCTTCTCGCTCGTCTCGGTCGTCTTCCTCCCCTCGCTGACACGCCCA
GGTTCGAGGTCCAGCTGGCAGCCGTCAAGGAGCGTCTCGAAGCCGCCAAGGCTGGCAGTACGCGTGGCCTGGGCTCGCCG
ACCGGTCAGGCCGGCTTCAGCTTTGCCAGCGCCGGCAGCCGCATCGCCAAGCCTCTGCGTGGTGGCGGTGGTGATGCCCC
GGCCGCCAACCCGACGGTGGCCAGCCTGCAGACCAGCGAGAATAAGAGATCCAGCTGGTTCTTTCAGAAGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62