GenePrediction:GLEAN_621 Details

Name: GLEAN_621
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1031308..1033729 (+ strand)
Length: 2422
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1031308..1031559 (+ strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_97:1031618..1032515 (+ strand)
Length: 898
Type: CDS
Source: GLEAN
Position: GCSC_97:1032781..1033073 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_97:1033139..1033729 (+ strand)
Length: 591
>GLEAN_621 class=GenePrediction position=GCSC_97:1031308..1033729 (+ strand)
ATGTCGGCCAAGACCTGGAACAACCCGCGCGCAGAAAGCCTTGATGGCATCCCCCACCCGCCGGTAGGCAAGGCTGGCGT
GTTGTGCTTTGACGACAACGGCTTCTACTCCTTCTCGTCCTTGCTGGTGCTGGAGCACATTATGAAGCGGATCGGCAACG
GAACCGAGACGCGTCCGTGCGAGCACTTTGACCTCATCTGTGGGACCGGGCTGGGCGGCCTGATCGCCCTCTTCCTCGGT
CGGCTGGGCATGGTACGATGTGTTGGCTTCGTGATCTGGATGCCAAGGGGACCATGCTGACTTGGCACAGACGATTGGCG
AGTGTCTCGACTGGTTTCGCAAGAATTTGCCCTCCCTCCTTCCTAGTGGCCAGGCGTCCATGTTTCTCGGCTGGGGAAAG
AGGCTGCGGACGAACAACCGAGCGCTGGAGCGGGCGGTCAAGGCGGCTGTGCGCGCTCGCGGGCTGCCCGAGGACGAGCC
GCTGCTGGACCCGGGCTTCTCGTCGGACAGCAGCAGACGGCCGGCGAGCTGCCGCGTCTTTGTCCTGGCGATGCACCCGG
GCAACATCCACGTGCCGATTCGGCTGCGATCGTACACGTCCAAGATGGACCCCGTGGCGGCAGACTGCTGTCTCTGGGAG
GCTGCCGTGGCCGCCGAGGCCTCGCCGACGTACTACACGCCCGTGATGATGGGTCACCCCCCGGTGCCGTACATGGCTGC
CTCACTCGGCTTTTGCAACCCTTCCAAGGAGGCACTAGACGAGGCAGCCCGAATCTGGGCTCTCCGGGGGGGCCGCTGCC
TCGTCAGTCTCGGCACCGGAAAGCTGCCGCCCCGGCTCGACCTTGACGGCATCCCGACCTCGTCCAGGCCTTTCCAGTTC
ACCCGGAGCATGCTCCTCATCCATACCATGTCTGCCATCGCCACCGACACTCAGCGCGTCCACATTGAGCTCAGCCGCGA
CGCCAAGTTTCTCGGCCTCCGATACTTTCGCTTCGAAGCGTCCGAAGGCATCTCGTACAAGTCCAGCTACGACAAGTCCG
AGGTCCTCCAGGAACGTGTCCGGGCTGCCGTGATCCGTTACGTCCAGCAGGAGGAAGTCTCCAAGGCACTCAGCTTCTGT
GCCGAACACCTCCATGGGGTGTTGGGTGGATCGGCACTGCCGCCAGAGCTCATCACACAGCTCTTCCCAGCGGTCAATGA
GGACGAATGTATGCTCATTTGGCTGTTGTCTGCTCTCTCAAGACTCATTGCTTACGCACACCGCACAGTCTCAGATTCGT
CGCTTACCTCACCTCTGGTGCGGATCCTCGATTCCGAGTTTATTCCAACAACGAAAGAGCAGCGAAACGCGCAAGTGGCC
ATCTCTACACGCAATGGACAGCTCCCCTGGTCCACCCAGCTGACTGTTGTTTTTTAGGGATCGATCTGCAGACGAATGGC
TCCGGCGGCTGCACAAACATGTGCATCCGGTAGTGCAGCAAAGACGAAGGAACAACGACAGAAGAGTTAAAATCGCCATC
TTGGACTCGGGACTGGATGCCCAGCACAAGGACATTATTCGCCTATCGCAGGACGACGACGGAAAGAGCAAGATCAGGGA
CGTCAAAGACTGGACGACATCCTCGGTTGGGACCAGCGACTCGATTGGTCATGGAACCTACTGCGCAGCGCTCCTGCTCG
AAGTAGCTCCCAACGCCGATCTGTACGTGGCAAAGGTCTTTGATTCGAGCACTGCTGACGAGGAGACGCCGACTCGAGTG
TCCGAGGTGCGTGCAAAAAGACAAATTCCCCGTGTATCGACAGGGGGACAACCCGCTGACACTTTGCACAGGCCATCACC
TACGCTGTCGAGACCTGGAAGGTGGACATTATCGCCATGGCCTTTGGCTTCCAGAAGCGGCACGAAGACATCCTACAGGC
AGTCAGGCTGGCGTACGACCGGGGCGTCATCATGCTTGCGGCCGCGTCCAACGACGGAGCCCTGGAAGAGAGACCGGCCT
TTCCGGCGCGGCTGGACCAGGTCATCTGTGTCAACTCGGCCGATGGGCTGGGCTCGAGCTCAGCCTTCAACCCGCAGCCC
AGCATCGCCGAGGACAACTTTACCATCCTCGGCGAGAAGGTCGAGTCTGCCAAGGTCGGCAGCCACCGAGTCCGCAAGAG
CGGCACGTCCGTGGCCACAATGATCGCTGCCGGCGTGGCTGCCCTCGTCCTCGAGCTTTCGTTCCAGCGACCGGCCAGCA
TGCGCGAGTCTGACATTCGCTCGTACTCGGGCATGCGTGCCGTGTTTGCGGCCATGTCCCGCGACACGTCGACCTTTTCG
ACCGATGGCAGGTACTTTATTCGGCCCTGGAAACTGTTGGACACGGAGAAGGATCTGGATTATATCCTCATGGATATTGC
GTATATATTGAATCGTCTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62