GenePrediction:GLEAN_6220 Details

Name: GLEAN_6220
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1460221..1458368 (- strand)
Length: 1854
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1460221..1458368 (- strand)
Length: 1854
>GLEAN_6220 class=GenePrediction position=GCSC_144:1460221..1458368 (- strand)
ATGGGCTACTCGACACAGCAGATCAACAGTGCCAGCCGGAGCACGCAGCCGGTGGGCGAGCCGCTGGCCGACACGCACGA
CTACGCCCGCTCGTGGGCCGTCAAGCTAGGCAAGGCGATCAAGTACAATCTCGGGGTCGGGGCGACGACACCGGCGACGG
CCGGCAGCAACAGCAACGGTGCGTCCACGGTGGCCGACACGACCAGCTACCTCGTGCGGCTGCCCCAGGGCTACTCGCTG
CACGTCCGGCCGCATCGCGGCAGCCGCGACGGCCGCAAAGGCAAGAGCACCGGCAAAGGCGGCGAGCGAGACGGACCCTT
TGTGTTTGGTCACCCGCTCGGCCCCATTGCCGCGTTTCGCAGCCCGGCCGAGCTGGCCCTACATCTGCTCTGGCTGCTGA
GCGACTCGACGTCGCGCGCCGACTGCTCGTGCCGCCTCTGCGTCCGCATGGTCAGCGATAGTCTCCCTCCGCTCACCGTC
CTCCTTCCGGTAGCAACAACACGAGCACCTACGCCAGTGCCTGTTCCCGTGCCAGCAACAGCAGCAGCACCTACGCCCGT
ACCTGTTCCTGTACAAGCATCAGCACCAGCGTCCGCGCCTCCACCTACACCCAAAGCTACCCTGATAGCCGCCTCTTTCG
CCATGTCCACCACCTCCACCTCCACTACCTCCACCAATCCTCCACCCATCGGCGGCAGCGCCGATCTCTTCCGGCCCTGG
GAGCTCGTCTGGTACCAGCCGCCGCAGAAGAACGCTTGGCGGCTGGGCATCGTGCTGCAGCTGCTACAGGCTCCGGGCGA
GAGTCGCAGCGCGGCCACGGCGGCTGCTCGCATCGCCCCCTTGGGCGCGCCCGGCCTGCAGACGGCCGAGCTGACGCTGG
GGGCCGACGTGCTGCGGCCGTTCCTGTCGTTCAGCGTGCCCGACCTGCGCGATGGGTTTCAAGGCCAGACGTTTGACGCG
CTCGACTGGCCGCGGCTGGTGCGCGAGAACGCCCAGGCAGCTCAGGCCGTCCAGGCCTATGCCCAGGCCCAGGCTCAGGC
CCAGGCTTGTGGTCAGGTGCTGCCGCCTGGCTCGGTGGCACCACCGCTGCCGCGCTTCGACATGGCCACCATCTCGCTGG
AGGCGTCCAAGGCGGCGGCCAACCAGATCAACGCCTGTTTCTCCGTCTTTGGCGCCCGGCCCAAAGTCTCGCCCACCCAG
TGCATCTACGGCGGCGTGTTTCTAGGCGCCGAGCAGATTGTCGTCGGCGACGCCGTCCGCGTGGACGCCCGTCGAGACGG
CGCAGCCGATGGGAACGGCAACGGCAATGGCAGCAGCAACAGCAACAACGGCGGCGACCTCCCGCCCGGCACCACCGACA
TTATGCGCATCAACCTGATCCTGACGGACCACGATCACCTGCGCTTCATCGGCGACGTGTATCGGCTGGCTCTGACGACG
GCAGCTGCCGGCAGCAACAGCAACGCTTCTGCCACGGCGCCTCCCGAGGGCCAGCTGTTCGCCGAAGAGCTGGAGGACCG
CAACGGGATCATGCTGGCAGCAAATACGCAGAAGAACCAACAGCAGCAACGTTGGTATTGGCACCTCAAGGAGCGCAACG
GCCATCGGGCCGAGAACGAGGTGCACGGCCGGTTCTACGTGTCGATGCGGCTGGCGGCCAACCTGCGCAAGGCAGACTTC
TTGGCCCAAGCGGCGGCCGGTCACGTCGGCGACGACATGATCAAGGCGCTGAACCGCCGTCAGCAGGTAGCCGGCTTCCA
GTACCAGGGCCAGCGGACCAGCCGGACCGCCACGATCGGAGGCGCCATTGGCGTGGTGCTGCCTGCTATCAGCGGCGTGA
TAGAAGACGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62