GenePrediction:GLEAN_6221 Details

Name: GLEAN_6221
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1448646..1444905 (- strand)
Length: 3742
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1448646..1448533 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_144:1448485..1448215 (- strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_144:1448131..1444905 (- strand)
Length: 3227
>GLEAN_6221 class=GenePrediction position=GCSC_144:1448646..1444905 (- strand)
ATGGCCTCGACCATCCTTGTCCGGGCGCCTCTGACCCCCGCTGTTCTGAGCATGGCGAACACCACAACGACCCCTCTTTT
CCGGTCGGTGACGTCGAGTGCGCCAGCACTGGGGGTGGCTTTGTGGGCACTCGTGCCGACACAAACCCTGTGGATATCAA
GAAGCTCGACGAAAAGCTGCGTCGATTGAGCGTCCAAGCTACCCGGCCTGGAGATATCCACTCGCAGGCGAAAACGCATT
CTGGGGAAAAGACTGCCGAAGATGCTGTTGTTGCCGCTTCTGCTGCCGTCACTCCTGCGGGCCAGCGTATCGCCGAGTAT
GAGCAGGCTCTTACCCCTTCGACATCGAAGCGTGGACATGGTACACTGCCGGATGCCGGCCTTTTTCCTGGCTTTCCTTC
ACAGGGAAGACAGCTTGTCGACTTTCCAAATGGTGAGACAATCCTGAGTCTGAGTTTCGGCGATTCAGTTACCCATTTTT
CGATAGGTCTTGCTCACATGCTTTTTTAAAAACAGAAATCTTGACGCACATCTTCTCTTACTTGCAGCCTGGCTCTCATG
CTGCAGTCGCCCTCGTTTCCAAGCGGTTCTACTCTCTGATCACCACCCCGCATGCATGGCGCATGGCCTTCCGGCGCTAT
TTTCCAGGACAGGAGCCGGGTTCGCATTCAGACACTTCCAATTCGCCTGTTGTGCTAGAAGATGTGGCCAAGTCGGAAGC
TCCTCTCTTCTCACGACTGACGTCTCTAGCATCGTGGCGGAGCGAGTATCTTTTGCGAACCCGCCTGCTTCGAAGCATTG
CTTCTGGGAAGCCTGGAGCTATCATTGGTGCCAATGGCGAGAGCGTTGGGGCGGTGCGGCCTGGTGGAGGCGTAAAGAAG
GCCACGGCGGTGATAACGTACAGTTCCCAGCTACCATGGATGGTAAATCGCCTGCACGCCGTGTTTTCCAGCACAGGAAA
GAAGTCGGCCCGGGTTGTGCATGGAGCCTCGGATTTGGGCGTTGCCACAGCAAGCAACCCAGCCATTGGCAAGCTCGAGA
GCTGGGGCGCTCGAGAATCCTTCGCTGCTGCACAGCTGGACGAGATATTCCCCCAGCTGACGCCATACGGACTTCACGAC
GGGCCGGCAGCAGTTCCCAACGTCATGGATATCAGCCAGCTCTATGGCAGCATCATCGGCGAGGGCTTTCCTGGAGGCCG
TCCTCTGTATCGCGCCATGGGCAGCCACGGCTTTTCCTACCTGGAGAACCATGCGAGAACCCGGAGCACGGCTCAGGACC
AAGATATCCCCAACATTTCCGAAGACTCGGAAGCTGTCTCTGCAGTGTGGGTAGCAAAGTCGGCTGCTGTCCCCGCGGTG
ACTCGGTCCATGATTGCGATGCTAGCAGGCACGACATTGGGTGTTGTGTCCGCCTACTCCTTGGCAAAGGCAGACTCTGG
ATCGCGGTACGCGCACAACCAAGTGACTGCGCGCTGGGTGCTGTGTCCGGGCATTCCGATTATCGCCATACAAGCCGATG
ACAGCTTCAGCGAGAAACGGAGGGCGATGGGCCGCGTCTGGGCCGTGGCACTGAATGCCCTGGGAGAGGTGTACTATCTC
CAGGATGTCCCCACGCCAGCTGCGAGTCCGGCTCCTGCACTTGGCCAGCGTTTGTCTGACGTGCATGAGAAGCTGGCATG
GCAGGCCGGTCGCACAGCAAGATGGGAGCTCGTGGAGCTGACCCGTCGGTCACCCACGTCGGACTGGTTTGATGCCAAGA
ATGCATCGCTTGTGTTGGCAGCATCTCCGTCACCGCCACGCTCGTCGTCCAACTCGATGAAACTCAGCCAGGAGCAGTTA
GTGGCTGAGGCTCGCGAGATTGAAAAGTTTATCGATCTCACGCCTGCTACTTACAGATCTGTGTACGACGACGGCTGGGA
CATGCGACGGAAGCTCGAGGTGGATTTCAGCGGTGGCCGCAGTGGCTATAGCACTGAAGCTGACGGCAATGCGGGCGAAA
GTGTTTTCGTCATCAGTTGTGGCATCGAGCCAAATGGACGCCCAGCCACGGTTACCCGCTTCACCCGCTTTGCCACGAGC
GCGACGACACAAGCGCCCTCTCCTGCCTTTCCTGCCTCTCCTGTCCGCTCAGAGTTGCAGCCCACGCCAAGCCACGTGTT
TTCAGTCTTTGGTTCTGGACTAAATACACCAGCCCCTCAAGAGCCTCGCGTACTTGTAGTGCCTCGAGTACAAGCGGCTG
CAGATGGACGGTCGACCCCCACTGCCGGTTGGCAATCGACGGAGTTGTCGTTCAAAACGGGCAATAACAATATGCACACG
GAGATCACTTGCACTGCGGTAGATCTAAGTGTCTTCTCCCTGTCGGCGCCCTTTGAAGACCCTCTGGTCCAGCAGATGGA
CGGGAAGCTAGATAGCGCTTACAGTGGGGAAATTCCTGGCCGTCGAGCGCGATGGATTGCTATTGGAACCAAGACTGGCG
CAGTGTTTGTGTGGAACATGCGCGAGACGTCATCATTGTCGTCGTCGGAAGCAGCTGCAGCGGTGCCGTCTGTGCGGCCG
CTGCGAGTGATCCAGACGGAGTCGCCCGAGGTTTCAAGCCTGGCTGTGTCGTCACTGTTTCTCGTGCATGGTGGAAGCGA
CGGGTTGGTGCAGGCATGGGACCCTTTGGCGTCTACGGTCGAGCCGATCCGGACGCTGAACTCGAGATCGCAGGGGCGAG
TGCCACGCCATCTAGCTCACACACGTCCCGAGTTTTCGCGGGCCAGTTTTTCAGTTGTGCGAGCCATCTTCCTCGACCCG
GACCCGACAGCCCTTCGTGGCGTGCTGGCCGTGGGCACTCTGCTGCGGTACTGGTCGTACAGCTCGAACAGTTTTGGATC
GAGCCGGAAGCGATTGCGCCGTGTTCGCCACGCTACGGCAGATGGACAGCTGGTCAGTCGGCGATTAGGCGTGCGGGAGA
ACGGCTATATTGCTGCTGAAACGGCCGAGCTGCGGCGTGAGCAAGAGGACGACTCGCGGCACCGCTCCTGGATGTGCAAT
CGTTTCGGTGTCGGCCTGGCCGATCTGACCGAGGAGGAAGCCGTTCGCTATGCCGAGATCATGTCGCAGGAGACGTTGTT
GGATGAGCAGGTCCGCTCGAGCGGTTTCAGCGGCCCCGACAGCGCCAACGGCTCGTCGGCCGACCAGGCATCGTTGACAT
CTTCGATCTCATCCAGCGCAGCCGAGACCCTGACGCCCGCGGCAAGTCTGTCGGAGCAGCAGAGTCCTCCATCAGCCACG
AGCCCGTCTGTTCTGGCTGCTTCCTCTGCTTCGGCCACATTTGTCACCGATGACGGCTTTGAGCTGCAGATTCAGCGCGC
CATCCGACTGTCACTTATGGAGGGCGTCAATGACGACAGCAACGGTGAATTTTCTGTGACGTATCGACCGGCAAAACAGA
GAGAAGACAAGGGAAAGGGAAAGATGCAGGCGCAGGTGTGGGAACCTGCGGTAGCAACAACGTCATCGTCCTGGCCCGAT
GCTGGCTCGTCGACGGCTGTTGATGGCGGCAGCGGTGGCAATGAAGACGACGACTTCCGGTTGGCGCTGGCCCTTAGTCT
GCAAGACGAAGAGCAGCGACAGTTGTTGCTGCAGGAGCAGGAAGAAAACGATGCTGTCTTGGCGGCGACCTTGTACCAAG
AGGAGGAATTTCCTGCACTGGAGGTCAGAGGCAAGGGGAAGGGCAAGGGCAAACACGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62