GenePrediction:GLEAN_6238 Details

Name: GLEAN_6238
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1348600..1346864 (- strand)
Length: 1737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1348600..1348564 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_144:1348490..1348356 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_144:1348275..1347526 (- strand)
Length: 750
Type: CDS
Source: GLEAN
Position: GCSC_144:1347460..1347146 (- strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_144:1347063..1346864 (- strand)
Length: 200
>GLEAN_6238 class=GenePrediction position=GCSC_144:1348600..1346864 (- strand)
ATGGCTCCCACAAAGCAGAGCTCGATTATCGTTGTTGGTATGCCGCCCGGTGCTACTAGCTCTACGTGTGCGTGTCTCTC
TTTGCTTACGGATCCATATACGTGCTCTAGGTGCCGGGGTTCTGGGTCTATCCACAGCTCTTGGCTTGCTCGAAAGCGGC
TACGAGAATGTCACCATATTCGACCAGCAAGACTTTGAGGAGTCGGAGTATTCGCCATTTCGAGGAGCCGACTCGGCTTC
AGCTGGTCAGTTTGATTTTTGGCTTATTCTCCTGTTCTGTTTGTTCTTTCCACTTCGTCCAAGTGTCAGCTCCCAACACT
CCCAGACACCCTAAAAGTCATCCGCTCAGCGTATGGCGGCGCCTCGCTTCACCACTCGCTGGCTACCGAGGCCATTGCCG
CCTGGAAGGAGTGGAATGGCGAGGCCGGCCGGGAGCTCTTTGTCAACTGTGGCTGGATGCGCATGAGCGGAACAGGCGAC
TTGGCCCCCGTCGACGTGGCAACTTTGGCGACCATGGCCGCGGCCGGTCAGGGCGCCACGCAGTATCGCGTCGGCGATCC
GGAAGACCGCCAGCGGGCAAGGCAGGACGGCTGGCCGACGACAAAGGTCGACCCGTTTGACCGCCTACGTCGTGGCTTTG
CTTTTGACGGCGTCCTCGACACCCTCGCCGGCTATGTCCACGCCAGCAAGGCCTGCACTTTTGCGCTGCGGAAAGCCAAG
CGCCTGGGCGCAAATATCGTCCTCGGAACGGCTGGCCGTGTCGATGCCATCGTATATGCGCCTGCTTCTGCTGTCAGCAT
CGGTGACCACCAGACCGTCGAGCGTGCCATTGGCGTGCGTACGGGTGACGGCCTGGAACACCTCGGCGACGTGGTCATTG
TCGCCGCTGGCGCCCGGACTCACGGACTCGTGCCAGATCTCGCCCAGTCCGTCACAGCCTCGGGTGCAAACATCATCCAC
ATCGACGTCCCACCTAGGCTCCAGGACAAGTTCAGGGCGGACGTCTTCCCGGTCTTTTCCTGGGGATACACGGGATTTGA
CGAGGACGGTGGCCTCAGCGGCTTTCCCCTTGACGGTAAGACAGGACCGGTCCACTCACCTTTACTTCTTTCAGAAGCTG
CTCTGACAGAAAATTTCCAGATGATGGCACCCTGAAGTTCCTCTACCGCTCTCCGAAATGGACAAACCCCATACAATCAG
CAGCAACGCCATCGGCTCGGGCTTCCGTAACCTCACGTCCAACAGCCTGGACTAGCAACACAAGGACAAATGTGCCGAAG
AATGTCCTCGACGCCGTCAAGGCTTTTATTGCAAGCAACATACCCGACCTGGTCGGCTGCGAGATCTTGATGGCCAAGCT
CTGCTGGGATTCCTTTGCATTGGATCTCGATTTTGTCATTGATTGGGTTCCTGGACGGGAAAACCTCCTCGTGGTTGCTG
GCGGATCTGGGCACGGTACGTTGCGTTACTACCAACAGTTTAGTGCGTGATCTAATAGCTCTCCCTCTTCTAGGATTCAA
ATTTCTACCAACGATAGGGAAATATGTTGTAAAGGTGGTTGAGGATCGTCCGGACCAGTATACACAACTGTGGAAATGGA
GGAACCCTTCGCCGGAGCAGATGACAAAGTTCGAGGCCTTCATGCTAGATCCACAACACAGATTGGGCCAACAGCAGATG
GCTACCATCTCAGATCTTAAGTGGGAAGATAGTCTTGGTGGTGGAGCAAAATTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62