GenePrediction:GLEAN_6239 Details

Name: GLEAN_6239
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1343439..1342630 (- strand)
Length: 810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1343439..1342630 (- strand)
Length: 810
>GLEAN_6239 class=GenePrediction position=GCSC_144:1343439..1342630 (- strand)
ATGCATTCGACATTTATTGGAACCCCTTACGACACCCTCAAGGTGGCTCACGCGATCGTGTCTGAATCCCTCTCCGCACA
TATGAAAGCTTTTCAATGGGCCAACTACAACATCACCACCACGCTCTACAGCAAGCTCGATCTCTGCGATGTCGGCGCCG
ACTTAGTCCTGAGCAGTACATTGGTCTGGTGCCCTCGCTCAGTGTCTGCCTGGAACTTTCTCTTCTGGCTGCTTTGCTTC
GCTACAAATGCCTTCAACCAGCCGACAGGCCGTGTGCTCGGCCTCTTCCACCCCCGGCACGCCGTACTGCGCTCCATGCC
TGTCCTTTACGCGACCGACGGCGTCTACTCTCTGCTCACCTGGATGGGTCAGGCTTTCGTAGCTGGCCACGGCATCCGCG
TGGGTGCCTCGCATGTCCTAGCCGCCCGACTAGTGCACCCCGATGGTCTGGCCAACGTCGACGCCTTCACGGGCACACGA
AGCCACGCTTGGCTGCGCTGGTCATCCTTTGTGGTGGGCGTGCTGCCCCAATATGTCAAGCTCCTGGCTAGCCGTGAGGG
CATGCCGGCATGGGTTCTGGCCGTTGAGATCCTGTTCTTGATCCCGTGGGTTGTCTTTGAGCTGCTCACTGCTGCGGCCT
GTCCTGACAATTTTAGGGCTCTTGCAATCACCGCAAGGAGTGAAAAGGAGATACGAGAAGCCGTACGTGCGCAAGAAACT
GCGGCCAACTGGAGACATAGCTTTCCGGACAGCTGGCTGCGGTCGCACCTCCTCCCTACGTTTTACCCGCAGATAAGAAC
CCTGCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62