GenePrediction:GLEAN_623 Details

Name: GLEAN_623
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1054004..1057778 (+ strand)
Length: 3775
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1054004..1054098 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_97:1054323..1054884 (+ strand)
Length: 562
Type: CDS
Source: GLEAN
Position: GCSC_97:1054960..1055223 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_97:1055293..1057212 (+ strand)
Length: 1920
Type: CDS
Source: GLEAN
Position: GCSC_97:1057545..1057778 (+ strand)
Length: 234
>GLEAN_623 class=GenePrediction position=GCSC_97:1054004..1057778 (+ strand)
ATGAGAATACGAGCCTTTGACAAACAGTCAGTTGTCCACCGCCATTTGAGCAAGAATTTCCGAGCGCCTCAAAAGTTTGC
CTTGCGCGAAGCTCAGTGAGTGCACCCGAGAAATTTCTGCAAGTACAGACGGTAAGCAGTAGCCACAGCCTAGAAAGAGG
ATAGCTTCTGGCAGAAAGAGACGATACTGTTTCACAAGCATCCTGCCATTTTTCAAAGTGTCGGCACGACAAAGACACAG
TAATACCCGACATAAATCTGCCACCCAACTCCATTTCGACCTCGGCCACGGCAAATCCGGTCAGTATATCAAACGCCAGA
GTTTTCCTAAATGATCTCCAGGACGTTCTGGGCTGCGTGGAACAATTTGAAACCACAACGACGGAAAAGGAAGCGGTCGG
CGATCTCGCTCAACTGCTAAGTGACCTCATCCAAACGGTCGAGCCGTTTCAAGAGCGGACAGCAAAAGGGAAACGAAAGG
AAGTTTCCCTGCAAGCACAGTTCAATGTAGCCAGACGACTACACCTGCAGCAGGTGTCCGATAGCGTGGAAGCCATTATC
GACGAGCACGTTGAGTTTGTCCAGGCACTCCCGGCGATCCTCAAGCGGCCTGGTCAGAGCGGGACGATTCATGATGGTTT
TGATGACGACCGTCTCCAAGACAAGTCCTGGTACAGGGACGTACGCGATAATCTGGGTCTCCAGACAGAAACACTCAAGG
CCCTGGGAATGGCCACCGATATTCTGACCCTTGACTATGACACCGGCCACGACAGCGGCCGACCTGTCGTGACGCAGTCC
TCCCTGTCGACCAGCCTCCACTTCCAAATCAAACTGGCAAGACAAAAAGCAAGGCTCTGTCAAAATTACGCTACACCCGC
TGTATGTGCTCGGTCCTCTGCCCGCCCTCCTGACCTTTCCCAATTGCCCAAATGCTGACATCACTCGTCGGGCCAGATAG
AGAACGGGCTCATAGTGGCCGAGTCTGTGACGCTGTACAGCCCTCCAATTCCCAACAAACACTTTGTCAACGTAAGAAAC
ACACGGGACTATTTTTCTGGCCGGGAGAAGCAGCTGGCACAGCTGGAAGCTGCATTTGCCGACACGCTGCTTCCACGCCA
GCAACGCTTTGTCGTCTACGGGCTGAGCGGGTGCGGGAAGACGGAGCTGGCGTGCAGGTTTGCACATCAGTCGCGGGATC
GGTTCTGGGGTGTCTTTTTTGTGGACGGCAGCTCGCGCAAGAACGCCCTCAGCACATACGCGGACATTGCCACTCACGGG
GGGGTCTAGCCGAACGACCGAGCAGCCAAGGACTGGCTGGTGACGCGAGACCTCCCCTGGCTGCTGATCCTGGACAACGT
GGACGGCGAGGATGCAGACTTTGCCGACCTCTTGCCCCAGGGTGCCAAGGGCTGCATTCTCATCACGACGCGCAACCCGG
ACTACAAGACGCACAGCAATGCGGGCAGCCGACACTTGGAGCTGCAGCCGATGGAGCCAGACGAGGCCGAACTGCTCATC
ACCACGGCGGCCGAGGAGCCACGGCCGTGGCGCAAGGTGGTCGTGGACTCGGCTGGCGAGATCTGCCACGTCCTGGGCTT
CTTGCCGCTGGCCCTGGTACAGGCAGCCACGGCCATCCTGCGCGGTATCTGCGACTGGCCGCGCTATCTGGGCTACCATG
AGATCCAGATGCAGCGGCTCCGGCGAGTTAAGCACAGCAGCCGGAGTCGAAAACCATGGGGAAGTCAGGGAGAGGATGCC
GGGAGGCTCGACAATGGCGACCGAAACAGCTTGAACGTCTTCTCGACGTACGAGATTCTATACGAGTCGCTGCTGGCGTC
ATGTCGGGAAGAGCACCGCGATGCAGTCGAGCTACTGCATGTCTTTTCCTTCTTTCACTTCCAGGACATCCGCCTGGAGA
CACTGATGGCCGCGGCTACGAATCCGCTGCGAGAAGAAGGCCAGGCCAGGGCCGATAGCGAAGAGGAGCAGGCGCTTCTG
CAGAAGAGTCAAATGCAGCAGAAGTCCGGCAGCCACCTGCCGCGCCGGCCGTGGGCCATGATGTTGCGCGAGTGGCGTGC
CTTTGTGTTCTCCAAACTGGCAATGCCACCATTTCCGCTTCCGGGAGTCTTGCGCAATTCAGAAGGCCTGGACCTGGATG
AGCTAGAGGTGGAGCTAGAGATCCGACTGCGTCTCGCCCTCGGCGCGCTTCTGGAGCGGTCGCTCATCATCGCACGAGAC
AAGGAGTCTGGGCACTACAGCATGCACCGCTTGGTGCACTGGTGGGTGCGAGAGCGACCTGAGATGTCCACCGCCCACCA
GGCAGTGTGGTGTCACGTCTCGGCGACCACGCTGGCCTGGAGTGTGCGCAGGCCACCGCACGGCGATGGCGACGACAAAA
GCCGGGCCCGGCGCCGGCTGCTGCCACACGTCCGCCACGTTCAGGAATGCCAGACGGACCTAGATCGACGGTTGGGGGCG
AACGCAGCCAAGCTGAGGCCATCATGGTCATGGTCGTGGCCAAGGGCCGAAAGACAGGTGCAGCTGACTGCTCACCAGTA
CGGCAGCAGCTGCTACTACAGACGCGTCCAGGCCGAGCAGGATGTCCGGTTCAGCCGTGTTTACGTCGACACCGGCTGTT
TTCATGAAGCGCGGCTGCTCCAGGAGCGGGCCCTCGCGTTTGTGTCTGGCCGCCTGGGCCGAGACCACCCGTTCGCCATC
CGCCTGTCTCTGCTCCTGTCGGTGACGCTGTGGCAGCTGTCCGAGATAGACGAGGCCATGCGGCACCAGCGAGAGGCCCG
GGCGCTCTGTATCGCCACCCTGGGCGAGCACCACCCCCTGACCCTTGACGTCACAGAGCTGCTGAGGTCGGCACTGTACA
TGAAGGGCCGCTGGGCCGAGGCCACCAGCCTGCACGAGCGCAACATCAAGACCCTGCACCTGCTCTACGGCGAGGCGCAC
GAGAAGACGCTCCGCTGCATGCGCAATCTGGCCCGGCTACACTACCACTACATGGAATATGATCGGGCCACGCACCTGTA
CCAGACGGCCTGGAGAGGCATGCGGAAGGCCCTGGGTGAAAGCCACCTGGAGACTCTGACCTGTCTGGAGGATCTGGCCA
TGAGCTACGTACGCTACGACGAGGAGGCCGAGCCTAGCACGACGGCCGGTGCTGACAATGCTAGTCTTGCGCTGAGCCAC
GAGCAAATGGTGTTTGTTCTTTTTCTTTTGTCCCTTTCCTCTATTTAACGCTATTAAACCTCACTACGTTGTAAACACGG
TGCTATTATAGAGACAGTCAGAGTTAATAATCAAAAATTTACGAAAACGCCTGACGGGTCTTGCCCAGTGCTCGGTTCGT
ACTCTTGTCCCAGCTTCTCGCGAAGCTTCTCGACGGCCTGTTCCACCCGCGGACGCATTTTGTGGCCCATACCTAAACCG
TTTCCACCAATGGCAGCTAGGCCCTTCAAGAAGGCCTCGCCAATACGCAGCGCTTCCTGCCACTTTTCCTGCTGACGTAA
GCAACTGAACAGCAGATACAGGTTGGCCAAACGGTCTGGATGGTCGCCGTCGGCATCTGCCAGCTGGCCGTACGGCTCTT
TCTCGATGAGCCGATAACAGATGCTCTCAGCGCTGGCAAATTGCCGGAGCCGCGTCAATACCTGTGCATAGACGGTCCTG
GCCAGCAGGAGGCCGATATGCGTGTCGCCAATGTTGCGCTCGGCCACGACCAGGCCGGCACGAATCATGGCCTCGGCCTC
CTCGCTCTGGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62