GenePrediction:GLEAN_6240 Details

Name: GLEAN_6240
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1333577..1331487 (- strand)
Length: 2091
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1333577..1333511 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_144:1333416..1332834 (- strand)
Length: 583
Type: CDS
Source: GLEAN
Position: GCSC_144:1332780..1331487 (- strand)
Length: 1294
>GLEAN_6240 class=GenePrediction position=GCSC_144:1333577..1331487 (- strand)
ATGGATTCGAACAATTTGAAACGAAAAGATACCACCAAGGGTCCGCCTTTGCGGATCCTATCCCTAGGTACGTCTGTGGG
CCGACTGGGATTTTGGAGGGCTGGACCGAGAGAGAGAGTTGAGAACGGAGGACTAACCGGGACTGTTTTTTTGTTTTTTA
GATGGCGGTGGTGTGCGCGGCTACAGCATCTTCATCATCTTACAGGAGGTCATGCACCGCACGTTTGTCGAGATGGAGGG
GCGTGCGCCTCATCGCAACGAGATTCCGAAGCCGGCGGACCACTTCGACCTGATCGTCGGCACGGGCACGGGCGGGCTGA
TCGCACTGATGCTGGGGCGGTTACGGCTGGACATTGAGACATGCAAGGAGCTGTACGTGCGATTAACGCGGATGGTGTTT
GAGACGGACAAGACGATCTTGGGCATCCCGACACGGTCGACAGTTTTCAAGGCGTCCAAGTTGGAGGAAGCCATTATGGA
GGCAGTGCGCGAACACACGGTGAACGAGAACGAGGGCAAGGATTCACGGTCGGGCAGCGGCAGCATCAGCAGCCCTTTGG
GTGCGGGAGGTGGCTCGCGTACGAGCTCGGTACCAAGACGCCATGCCAGCAACGCCAGCGTGGTCAGCTTCAGCGCGCGC
AGTCCAGCAGCACAAATGGCACGGCCTTACTTTTTCACGAACAACTACCACCGGGGGGACCCGAATGCGTTGTTGTATGA
CGCGAGAGAGTGTCGGACAAAGACGTGAGTGTGAAGGGAGGAAAAAGAGAGGGAGGAAAAAAGCTAACTGATAACAGAGT
TGTCACAGCCACCTACAAGGGAGCACCACGAGGCGAGGAGCCGGTAATGCTGCGATCATACGACTCCCGGCGGGAACCGG
CACCAGAGTTCGACTGCCGGATCTGGGAGGCTGGACGAGCGACGTGTTCGATTGGACTGGCGTTTAAGCCTATCCAGATT
GGACAATCGGTGTTTCACGACGACGGAGCGGGGACGTTCAATCCGTCGCCGTTTGCTCTGGACGAGGCGACGGTGAACGA
GTGGCCCGGCCGGGAGGTGGGAGTGTTTCTGAGCGTGGGGACAGGCAAGCGACCGGCGGGCAGTGACAACAATCCGATGT
GGTACGAAGGGTTCTTGGGAGAGTTTGCCGAGGCCCGTCGGCGGCTGGTGGCCAAGATCGAGGGCTGTGAGAAGACGCAC
AACGAAATGGTGCGTGAGCACCTGTCGAAGCGCGGCGTCAACGTGGAAAACTACTACCGGCTCAACGTCGAGGTGGGCGT
GGGCGAGTTCGGGATGAACGAGTGGCACCGGCTGGCAGAGATCAGCACGAGCACGAAGCGGTACCTGTCGCGGCACAAGG
AGCGCGGCATGGTGCAGTCATCAGCGGTAAAGCTGGCCAAGATCCACCGAGCCCACACGCGGTTGAACAAGCAGATGACG
GAGGCGCCAGAGCAGAAGCAACAGCAGTACATGCAGTATCTGCAGTCGCCGGAGATCTCGATGCCGCTGGCCGTGGAGCT
GCCCGCAGACGTGCCGACGGTGTTCTCTCCATCCGGCAGCTCGGCCGTGCACACTCCGCGGCAGTCGTACGAGTCCAACA
ACACGGATCGGCTGTCGGTGGCCAACAACGGCAGCCCGTCGCCACGGAGCTCGGCCGATCGGTTTCAGCAGCAGCTGAGC
ACGACTTCCGAGCTGGCATCGACGACCTATGTGCCTCCCAAGTCCTCGGGCAGCAGCGGCCAGACGCGGGCGCATAGCGC
GGGAGGGCCATCAGGCGGTGACGACCATCTGACGGTATCGGCACCGACGCCGGAGCAGTGGCGCTATGCAGCGGCGGACA
CGCGCAGACAGGCGGCAGCCCAGGCGGCAGCGCCGGCAACATACCGCGTCGAACCGCCACCATTGCCGCCCAAGACGCCG
CTGCCGGAGGGCAACGGACGGCCGAGCAGCCGCGGAGGCGAGCGGGGTGGACGACGCCGGGCGACATACACGTCAACAGG
AGTGGCTGGAAGCGCGCCCTACCCACTGGACGATGACGAGAGGCCGCCTCCAGTCAACAAGGCGAGAAAACCAGAATACA
GGAGTCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62