GenePrediction:GLEAN_6241 Details

Name: GLEAN_6241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1330959..1329518 (- strand)
Length: 1442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1330959..1330903 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_144:1330841..1330299 (- strand)
Length: 543
Type: CDS
Source: GLEAN
Position: GCSC_144:1330102..1329880 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_144:1329765..1329518 (- strand)
Length: 248
>GLEAN_6241 class=GenePrediction position=GCSC_144:1330959..1329518 (- strand)
ATGGTCATTGTGGGTGCCGGCTTGACGGGGCTGTTGGCAGCGCAGGGCCTGAAAAAGGTGGGAATTTTTTGTTGAAGCAC
GTCTGATCCTGACCTGACTGACCTGGGACCTGCTTCAGCGCGGCTTCGACGTGGCCGTCTACGAGCAGGAGCCGCATGAG
GGCGCGCGGCCGCGCGACTGGACGATCGTGCTGCACTGGGCGCTGCCGGCGATGGAGGCGCTGCTGCCGGCCGACGTGCG
TGCGGCGCTGCCGCAGGCCATCTGCAACCGGCACCTGGTCTTTGACACCGAGGCCGAGTCGTTTTTGTGCTACAGCGGCC
TCACCGGCGAGCGGCTCTTTGCCAGCAACATGCCGGGTTCGCGCCGCGTTTCGCGCCAGCGCTTGCGCCACGTCCTGGCA
ACCAGTATCGATGTGCAGTGGGGGAAGGCAGTCGAATCGATAGACGACCGTGACGGCAGGGACGACCAAAAGATCTGCCT
CTCCTTTGCTGACGGCACCACGGCTGAGGCTGACTTCGTCCTCGGCACTGACGGCGCCTCGTCCAGGGTGCGCTCGCTGC
TGGTCGGCCCCGAAAAGGCGCAGAGCACGCGGTCCGGCCTCATGTTCGGCACGGCCATCGTGCAGTACAAGGACGCGGAC
AAGGTGGCCGCTGTAGTCCGGGTACATCCCGTGGCTGCGGCGTCGATGGGCACCGATGTTGTAGGGGCATGCTGTGGTGG
GTTTGTTTTCGTTCTTGTTTTTGTTTTGTTTTGATTTTTATTTTGGCGTGGGGTCTCGAATCATATTCGCTGACGGCACA
GTCATACACGCCAACAAGCCCGACGACATGACTGACTGGACCACCTGTTGGATGAAGATCTGGAAGGACAGCATGGCCAG
CTTACAGGGCGAGGCCGCGCTCGAGTACATGCGGACGCACACGTCCAAGTTGTGCCCCATGTTCCAGGACCAGGTCGACT
GGACGCCACCCGGATCTGCCTGCAACGTGGACGAGATGCGCTACTGGGTGCCCGTGCCGTTTAACAACCACGACGGCCGC
GTGACGTTGGCCGGCGACGCCGCGCATCCGATGCTGATCTGTGAGTGTTGGCTTGTTTTCGTTTTCGTTTTCGTTTTCGT
TTTCGCCCTCGCCCTCGCTTTCGTTTTCCCGCTCGTTTTCCCTCCTCTCCCACTCATCCGTTTTAATAATAAAGACCGCG
GACAGGGCTACCAGCACGCCATTACCGACGTCGACAACTACATCAAGGCCCTCGTCAAGATCCGCGACGCCGGTTGGGCT
GCTGGCGTACGCACCAGCGAGTTCGCCACCTATGACGACGACCTGGTGACGCGTGGCGCCGCTGCCGTTGAGCAGTCCGT
CCAGGAAGCCGAGCTGTCATTTGACAAGGACTCCATCAGCAAGATGCGGATGGTGCGCAAAGGACACGGCCGATCAGCGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62