GenePrediction:GLEAN_6242 Details

Name: GLEAN_6242
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1328728..1327356 (- strand)
Length: 1373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1328728..1328317 (- strand)
Length: 412
Type: CDS
Source: GLEAN
Position: GCSC_144:1328244..1328227 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_144:1328162..1327964 (- strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_144:1327881..1327356 (- strand)
Length: 526
>GLEAN_6242 class=GenePrediction position=GCSC_144:1328728..1327356 (- strand)
ATGTGCGACTGTTCGGAAGCCGCACAGCCCGACAGTCCTGGCGCTGCTGCTGCTACCACGCACGTATATGCAGGCATTCT
CAACGGCTCTGCGATCGAGGCCGCGGGCAGCCAGGAAGGCGACCCCGACGAGTTTGAACGGGTCGACGGCTACGAGACCG
GCTACGAGTCTGGCAGTGGCGAGTCCCTCGGCTCGACCAGCGCCACTTCCAGCATCTACGCCCACACGTTTGAACACGGC
CGGCGCTACCACCACTTCAAGAATGGCCGCTACCCGCTGCCGGACGACGACGAAGAGCAGAAACGCGAGGACATGAAACA
CGCCATGATGCTGGAGCTGACCGACGGAAAGCTGTTTCACGCGCCCGTCGGTGACAATCCCCAGCAGATTCTGGACATTG
GCACCGGCACCGGTATGTCTGATGTCCCCTCTCCGGAATACGACGTCTGCACAGTCTTCATAGCATGCTGATTTTCTCAA
AAAGGCATCTGGGCCATTGACGGTAAGATTTGGTCGCCTCTTCCCTCTTCTTCCCCTCTCCTTCGCTCTCCCCTTTAACG
ATGCAGTCGGCGACAGGTATCCAGGTGCACACGTCCGTGGCATCGACCAGACACCAATCCAACCTATCTGGGTACCACCC
AATGTCGATTTTCTCGTAGATGACTGCAACAACGACTGGCTCGCCCGCAACATCGATCTGGCTCACTTTCGCTTCATGAC
TATCGTCCTGCAGGACGTCCCCAATGTACTTGGCAATTGCTTTGAGTGGGTACCCTCTCTTTCTTCATCCTTCACTTCCT
TTTTTCTCATCTTCCACTTCCCCTCCCTACCCGACTGACCTGAACAGGAGTCTTAAGCCTGGCGGCTGGGTCGAGCTGCA
AGAGCTGCAAGGTGAGATCCTCTGTGACGATGAAACAATGCTTGACGACGACCCGCTCAAGTACGTGTACGAGCTCGGCG
CCAAGGCCTTTAAACTGTTCGGCATGGACGTGTTAATCCCTCAGCAATTGGAGGCTATTCTGCGGGCTGCCGGCTTCGTC
AACATCCAATGCATTCCTAAGAAGGTACCCATCGGTGTCTGGGCCCAAGACAAGACACTACGCCTCGTCGGCCTCTACCA
GAAGACGGCCATTTCTGAATTCTTGAGTGCCATGGCTGGTCGTCCGTTTGAAGCCCTTGGAATTGATGCTACTGCGCGTC
AGGCCATCGTTGCCCTTGCCCGCCGCTCCCTCGAAGACACAACGATCCACCGATACATGCCCTACTATTTTTGGTATGCG
CAGAAGCCCGAGAATTTCTCTAACAGCACTCGCGGGAGCGCTCCCGGGAACACAGGCGCCAGCCTTGCAGTCAGCCCACT
CGCGGATGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62