GenePrediction:GLEAN_6243 Details

Name: GLEAN_6243
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1325633..1323886 (- strand)
Length: 1748
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1325633..1325455 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_144:1325407..1325019 (- strand)
Length: 389
Type: CDS
Source: GLEAN
Position: GCSC_144:1324947..1324902 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_144:1324819..1323886 (- strand)
Length: 934
>GLEAN_6243 class=GenePrediction position=GCSC_144:1325633..1323886 (- strand)
ATGTTGCGCGAGATTGCATATGCCCTTCTGGGGCTGACTGCCCTAGCCTACACAGTTGAGTTTATTTTCAGTTTGTTCGA
CGATCCACGCGAACCTCCTCGTGTGAAAGCCGCCATCTCGCTGATTGGCCATATCATCGGCATGATTCGCGAGGGAAAGC
TGTACTACAATTCGCTGGGGTAAGTGCGTCTGCGTGTAGAGTAAGCACAGCTACTAACCAAGCCAGCGCCAAAGTCGACT
CCGATATGTATATGATTTCCATCTTGGGTTTCAAGATCTACGTCTGCAACTCGTATCGTCTCATAGGTGCCATCCACAAA
AACGCCAAGACCCTCGCCTTCAAGCCTTTTGTCAAGCTGTCCATGAAAAAAAACAGTGATGTTTCTGATCACGCCTACGA
GATTGGCAGCGGCATCATGACCGACAAGCTCGAAACCGCACAGCGGGCTGCCCTGGCCCCGGGCGCCCACCTAGATGCCG
TGACGCTGCGCACGGCCGAGGCGATGTTGTCGGGGCTTTCTGCCCTTGAGGCAGCTGTCGCCAGCAAGGAGTCCGTTATG
CTCTTAGCCTTCCTGCGGCACAATATCGTGCAAGCGTTGGCGTACGGAATCTACGGTAAACCCGGCCTCGCTTAGCAGTT
GGCAGCACCTTGGATCTAACGGTTGTTTCTGCTGGGAAAATGATAGGATCAACTCACCCTTGGAAAGACCCGAAAGTCGA
AACAGCATTTTGGTAAGTACAGAAAAAAAGGGATATGGATTAGCAGGACTTTGGCAACCGCCTGAGTGAGATCGACTCTG
ATAGTTGGCTGCAGGACTTGGCACGAGTATCTGCCCAAGATGTTCATGGCGAGCCTCTTGGCTGGAAAGGGCTTCCAGAA
TCGCCAGGTGGTGTTTGATGCCTACCATAATTTTTTCCAGGATCTGCCCGACGATACTTCCGAGGTGTTCCGCGAACGCC
AGCGCGTGTACATCGAGGCTGGGATCGAGGAAGCTGACCACATCAAGCTCGAGGCTGCCTGGCCGTTAGCTATCTTTTCC
AACACGGTGCCGACGGCATACTGGTTTATGTGGGAGCTGTGCTCGCGGCCGGCTCTGCTCGCTGAGGTGCGCAGCGAAGT
AGAGGAGGTGGTCATCAAGACACAGAAGACAGCAGATGGGCCGGAATTCTGCCTCGACATTGCGGCCCTGCGCACCCGCT
GCCGCCTGCTTCTATCTGTGCTAGAGGAAACCCAGCGAACGCGCCATATTCATGCATCTATGTGTCGCGTGCTTGAGGAC
ACAGTGCTGGACGAACGCTACCTGCTCAAGAAGGGGTACGTTGTCCAGCTGCCCGGTGGCCCGATCCACCACGACCCTAA
TGTCTACGGGAGCAACGCGGGCCAGTTCGAGCCCCACCGCTTTGCCCCGAGCGACACTCATGGAAACGAGGGGAAAGTCC
CGACACACGCTCCCACCAATAGAGGCTTCCTGGCCTGGGGTGCACCTCCTCACCTTTGCCCCGCCCGCCAGTTTGCGGCC
ACTGAGCTGCTGCTGATGGCATCGTTGCTCATCCTGCGCTTCGACATCCAGTTACCCAGTGGCCGTGATCGGGATCCCTA
TCCGGCCCTACGTGCAAGCGAGATTGCTACCCTGCTCAGTCCTAAGAAAGACGTGGCCCTACAGATGACGGTGCGGGAAG
AATGGCGCGGAAAGTGGAGTGTGGCGTTCGGCAAAGAGAAGAGCAGGGTATTGCTTGCGTCTGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62