GenePrediction:GLEAN_6244 Details

Name: GLEAN_6244
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1321490..1319797 (- strand)
Length: 1694
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1321490..1320817 (- strand)
Length: 674
Type: CDS
Source: GLEAN
Position: GCSC_144:1320434..1320212 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_144:1320117..1319797 (- strand)
Length: 321
>GLEAN_6244 class=GenePrediction position=GCSC_144:1321490..1319797 (- strand)
ATGGAAACCCGCACGTATGCTGTGGTGGGTTCGACAGGAAACTGCGGCACAGCCTTGATCGAAAACCTGTGGAAACGGGA
CAATTCTATAATTCATGCCTACTGCCGCAACCGGGCCAAGCTACTTCAAAAGCTCCCTTTCACCCAGGGCAGCAAGCGCG
TGGCCATATTCGAGGGCGGTATCGACGACGTCCCGCTGATGGTCCAATGCGTCACTGGCTGTCGGGCTATTTTTCTGGTG
GTCTCAACCAACGACAATATCCCGGGCTGCAGTCTCGGCCAAGACACAGCCAAAAGTCTGATCACGGCCCTCTGTGATAT
CAAAGATGAAATCACCACCAACCCCAACCAGAACGGCAGCACCGGCACTCTTCTGCCCAAGATTGTTCTTTTGTCATCGT
CGACACTGGATGACCATCTGTCGCGGCATTTGCCACCAACACTTCGCCGGCTGCTGGTTCGGGCTGCATCTCACGTCTAC
AATGACCTTGCCGAGACTGAGAAGCTGCTGCGGGCCGAGAAGGACTGGCTGACTAGTTTGTATGCCATGCCCGGTGCGCT
GTCGGTCGACATCCAGCGGGACCACGCTATTAGCCTCACTGATCATGACGGGCCTCTGTCCTATCTAGACCTAGCTGCCG
CCATGATCGAAGCCGTGGATGATGAGGCCGGGCAGTATGACCACAAGAAGTTCTCCGTGTTGAATACGAATGGGAAAGGA
AAATTCCCTGCGGGGACTCCCATATGTCTGGTTTTGGGTCTATTGCGGCACTACTTTCCCTTCCTACGTCCTTATCTTCC
AACAAACACAGGACCGTAATATGTATGAAATAGATATGTTTGACGAGTGATATTGTTTGCTCCATGATATCTGGTTCTGT
GTTAGGCCTCGCTGCGGAAGATAACACAGTTTCAGCAAATGATGAGAGTCCTTACCTGGCGAAATAGCCCGACATTGTCG
CGAGGGAGGGACATTTTATACAACGTAAATAGCCCATTATTGTCCCGGTAGTTTCCTCGATGCATAGAGCCATCATAATT
ACCAGAATTAATGAAGAGCAGTTACAATGGCCCAAACGTCTACGCGCGAGATCCAGGCTGCCACGCTACAGCGCTTCATC
GAGGGCTGGGCCTCCTGGACTCCCGAGGGCTTCCTAGATTCCTGGTCCGACAACTGCACGCAGCAAAACCTGCCCTTTTG
CCAGAACTCACCAGTCAAGACCCGCGAGACCGTCGTCCTCTTCTTTCCCATTCTCATGTCGATTTTGACTAACTTCAAGG
TAAGACAGTAACCGAACGGGGAAAAAAGCAAAGAAAAAACAAAACACGGAGACACCATAAACAAGCAACAGATAACAAAA
CTAACTTCTACAGCTCAAAGTTCACAATATTGTACACGAATCGGAGACGGGCAAGGCGGCCATATACGCGCAAACGACGG
CCGACTCGCCGTGGGGCCCTTACCAGAACGAGTATGCACTCTTTTTGTGGTTTGACAAGACTGGCGAAAAGGTCCAAAAC
ATCGAGGAGCTCTTTGACACTATCGTGATGGACACATTTCTACCCAAGATTCAGGCGTGTACGAATGAGATTATGGCCAA
GAAGAAGAGGGCAGCTGCCAGTGGCACCAATCCAGCTGTGGCCACTGAAACGGCCGTGGTAAACAGCACTGTAGGAGAGC
TGCCGCCAACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62