GenePrediction:GLEAN_6245 Details

Name: GLEAN_6245
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1319489..1317782 (- strand)
Length: 1708
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1319489..1319263 (- strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_144:1319200..1318056 (- strand)
Length: 1145
Type: CDS
Source: GLEAN
Position: GCSC_144:1318005..1317782 (- strand)
Length: 224
>GLEAN_6245 class=GenePrediction position=GCSC_144:1319489..1317782 (- strand)
ATGAATTACACCATCATTGCCACGTATGAGACGATACACCAAGCAGTGGATCTGGTGGCGATCCCGTCCCAATCGTCTCT
TTTGGTCGTGATCGGCTTCTTGACGGCGGGCTTTGCAACCTTTCTGGGCTATCTAGCCAAGAAGCCGCCTGTGAACTACA
AGTCGCCGGCCTTCATGGGAGACATGGTGCCAGTTTTGGGGGCTGTTGGGTTTACTCTTCGGCCATGGTAAGCTTGCACC
CCTACCATAGCCTTTCTATACTCTGTTGATTTTGCTTACCGATTTCCAGGCGTTTCTGGGAGGCTACGTCGGAACTCGCC
AAGAAGTCCACGGGCAACTTCAGCTTTTGGGTGGGCAAGCGTCATCTGGTCGGCCTCACCAGCTCGGCCTCACGCAAGCT
TTTCTACGAGCACCCCAACCTCGATCTTGTCAGCGGCGGCATGCTGCTGCCATGGGGCGCCCACTTCTGGCCGCCTGTGC
ACGACATTTTTCGAGCCGGCTACGCCCGCGGCATCAACAACACGTACTTTTTGCGGCGTCTCGTCGATGCGCAGACGTCG
CGCCACATAAACAGTTGCCTGCCACAGCTGCAGAAGGATGTGGTCCGCGGCCTAGGCGAGCTCGTGGAGTGCAGCAAGTC
GCGTTGTGTCATCAGTCCGCCCGACCTGTGGCGCATCATCTTTGACCAGAACAACCGCCTCCTGGTGACCGAGCAGATCG
TCGACGACGCCAAGCTGCGCCGCTTTGTCCACGCCCAGGGCGACACGTTGCTTCACACAAACAGCCCCTTTAATGTGCAG
CTTCCTTGGTTGCCCTCGCCGTCTTGGGCTCGCCGCCGTCTCGCTCGGTACCGCCTCGAGTCGCTGGGTGTCCAGCTGAT
CCAACAGCGCCAGCAGCACGGCACATCGGAGCGCTATGGTGACAGGGATGTGCTACAGTCGCTTGTGGACCACGGCGACC
GTCGCGACTGGATCATTGAGTACTTTACGAGCGCCATATTCATCGCTAGCACCAACGCCGGCGTCATTGCCAGTCAGGTA
CTCAACATCATGGCCATGTATCCCGAATGGCAGGAGCGCGTGTTTGCTGAGGTGCAGGCTGTGGCTGGGGCGCACTCTCT
GGACAAAACAGTGCCACTGGTGGAACGTCTGAACGCGGTGCCCCTCGAGGGCTGGGAGTCGGGCTTCCCCGTCATGTATC
GGGTCTTGAAAGAGTGCATGCGCATGTGGGTGTCGTTCAATGCGTCGCGTTTTAACACCTCAAGTGACCCCATCTTCATC
CCAGGCTCCGACGAAGTCATTCCGGGCAACACATTTGTCATCTACAACACAACCGAATGCAACTTCAACCCAGACCTGTA
CCCGAACCCGACCAAGTTCGACCCAGACCGCTATATGGAAGGTCGCAAGAAGTTTGAAAAGGAGCAGTATGGGTGTAAGT
CTCGTTTCAATCTTAATTTTTTTTTTACAGATTCTAACCTTCAGATCTCGGATGGGGCCAGGGCAAGCACCCTTGCGCAG
GCAAGCGCTGGGGCAAGTTACAGCAGACACTGGATTTAGCGTATGTCTTGGCCATGTACAAGCTCAAAAGTTGTGACAAA
GACGGCAACATTGACGTCCAATCCATGCACCGGAAAGAATTGGACTCCCGGGATCCGTTTGTGCTGCCTCCTTCCTATGT
CAAGCTGGAGCCGAGAGAAAAGGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62