GenePrediction:GLEAN_6246 Details

Name: GLEAN_6246
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1316804..1315241 (- strand)
Length: 1564
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1316804..1315883 (- strand)
Length: 922
Type: CDS
Source: GLEAN
Position: GCSC_144:1315791..1315583 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_144:1315522..1315241 (- strand)
Length: 282
>GLEAN_6246 class=GenePrediction position=GCSC_144:1316804..1315241 (- strand)
ATGCCACAAAAAAAAGTCTACCAAATACGGCCGTCGGGCTGGCAGAACCCCAAGGAGGAATGGAGGCGCATGTCGCCTGT
CGATTACGGGACATACTGGTGGATGAACTGGATTTGCATCTTTCAGGTCCATAACGATGCAGACAAGCCGGAATTCCTGA
TCAACTTCAAGGCCGGCCTTGAAGCCACACTGGGACAGTGCCGCCATGCTGCTGGCACATTTGAGCGCAATAAATTCGGC
GACTTTTCGATTGTGACGCGGCCCAATAGCACGGCCACCTTTGTCGAGCTGTGGCTGGATAGGCCAAACGACACGGAAAC
CTGTATCCCCTTCAAGGAATGGAAAGAGCATCACAACTTTGCCAGCGAATCCCTTATGTCCAACCCTAGCAGCCTCGTGG
TCTTTCCGAGCTCCTCACCAGCTTCGCCAGATATCCCCGGTAGCCCTCAACCGACGATGGCCTTCCAGCTGACTTTCATC
AGGGGCGGTGCGATTTTTGGTCTCAGCAGTCACCACTGGTTCATGGACGCACTGGGTTGTGGTAGTTTTATCAATCAGCT
AGCGGCTAACTGCGCGGCTGTGGCCTACAAGACAGTCCCGCCTGCCTTCGACGAGAATCTCATGGACCGCTCGCGCTTTA
TCGGCCCATCGCTGCCTGAAAATGACCTCGTGGACGTGTCGCCACCGCCTGCTCTCCACACAAAACGACTTCCCTACGCC
TATCTCCTGTTTCGGCTGCCGCACAGCAAGGCGGCCGAGCTCAAGATGTTGGCAACACCTACTGACGGCAGCCGGATTTC
GACTTACGATGCCGTTGTGGCCTACCTCTGGCGCATCAATTCTAAGAACCGGGCATCTATCTACAAGCCGACGCTGTGGT
CGAAAGCTATATTTGGGGAGCCGGTGAATATGAGGAATAAGAGTGTGTATTTCGGTTATCTCCCGTATCAAGTTTCATTA
TTGTAATGTCCTGTTTCTTTCTAACAAACCAATCACTCCACCCTTGCCTAAAGACTACCAAGGTATCATGGCATGCGGTT
CCTTGTCTCTCTTCCAAAAGAAGCCACTGAAGCTGTCGGAAGTCATCTCCAAGGCGCCTCTGCCCAAGGTGGCCTCCTTC
ATCCGGACCATCACTGACAGCGTCGATGCCAAAACACTCGAGAAGCACATTGTTAAGAACAGACGTGCACGCGATAAGGT
CAAACTTCACAAAACTTTGGACGTGGGTCTTTCTCGGTTTCTGTCTTTCGTCCCGGATTTCCTTGTCTTTGCTAACAAAC
AGTGGCTCCCTCCCATGTCTCTCGTTTTGACCGACTGGCGCGGCGTTGGCGTGTGTGGCCGGGACTTCGGCGTCGGTCGC
TGTGTGGCATTGCGTGCGCCTTCTGACGATGTCGTGGCCAACCTTGTAATTTTGTATCCGCTGCGCCAGGTTGAAGATAG
CCCCGACCACGGCTGGGAGATAGTGCTGCCGTTTGAAGAGGCGCATGTCTACTCGCTGCTTTCGGACCCCGACCTCAAGC
GCTTTTTCACTTTCTGCGGCTACGAGGCACATGCTGCCGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62