GenePrediction:GLEAN_6249 Details

Name: GLEAN_6249
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1302916..1301554 (- strand)
Length: 1363
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1302916..1302580 (- strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_144:1302515..1301554 (- strand)
Length: 962
>GLEAN_6249 class=GenePrediction position=GCSC_144:1302916..1301554 (- strand)
ATGCGCGCCGAGCTCGCCCGCGACCGCGTCGATGCCGGTACCTACTACTACTGCTTTGACGGCGAGCTGATCGACGGGCC
CTCGAATCCCAATTTCAACGAGCCGACCTTTGTAGCAGAACGTGCGGCCCGCCACGCCAATATCCCGGGCGGCTTTCCCG
AGACCGGCGCCGTGCAGATTCGCAAAAAGTTTTTCTGCATGCTTCTACGGCAGGTTGCCTGTCTGGGCCTCAGAGTAGAG
TATGGACAGCATGTCGAGAGCTACGAAGAGGAGGACACTAGCAAGAGCGTGGCAGGTGTAGTGTTAGCCGACAGGTCAAA
GCGTCAAGCACACGTCGGTACGTTTTTTCTCTCCTTTTGTGGTTTCATTTGTCTTTCATTCCTGCTCACTCTTACCTTAA
GTCATCGCTGCCGATGGAATTCACTCGCTCTCCGGGGAAGTCATGCTGGGCGACCACACAGCAGGCATGCAGCCGAGCGG
CATGTCGGTGTACCGTGCGGTGTTTCCAGTCGAGCACGCATTTGCTGGCTCAGAACTGGTGCGCCAGCGCTGGCAGGGCC
GTCACACGTACGAATTCTGGATGGGTAGCGGCATGCATATTGGCCTCTACGTGTCAGACGAGGTGGCCGCGCTCGGCATC
ACACCCCGCGACGAGTTTCTCGACCCTGCCAACGCTTTTGCCAACAATGAGTCATGGGACCCCCAGGTCAGCCCGGACGA
GGTTGTTGCGGTCATGCAGCGGGCCATGTCTGGGAGCGGCGAGGGGAAAAATTGGCACCCCGTGCTTGAGGAGCTCGTTC
GCACCGCTCCCGAGGGAAGCATCATCCACTGGCCACTTTTCTGGCGCAACCTGCAGCGCAGCTGGGTGTCAGCCACGGGC
CGTATCGTTCAGATCGGTGATGCAGCCCATTCCACCGTGCCTGCATCGGCGGCCGGTGGCACGCTGGCTCTTGAAGATGC
CGTCACCGTGGCCGCTTGCTTGCGGCGTGCAGGTTCGGCTGATAACATAGCACTTGGGACACGCATCTACAACATCCTGC
GCTATGAGCGGTCGAGCTGCACGCAAAAGATGGCGTTTGTTAACGCGCAGACGCTGGGCCACACCACCGACTGGGATGAA
TTGCGTAAGGATCCGGCCAAAGCGCGGTTGCGGTATCCCAAATGGCTGTTCCGACACAACCCGGAGGTATATGTGGAGGA
GAAGTGGGCAGCGGCGGTTGCTTATGCAATTAACGGGGTCGACTACCACAACACAAACATCCCACCCGGCCACCATTTTA
CACATTGGACTATCGAGGACATCAGTCGACAGATTGCGGAAGGAAAGCGAGTAGAGGATCTCCTAGATGGAGACTGGTCG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62