GenePrediction:GLEAN_6251 Details

Name: GLEAN_6251
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1295824..1290240 (- strand)
Length: 5585
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1295824..1295490 (- strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_144:1295437..1295134 (- strand)
Length: 304
Type: CDS
Source: GLEAN
Position: GCSC_144:1294897..1293556 (- strand)
Length: 1342
Type: CDS
Source: GLEAN
Position: GCSC_144:1293196..1291497 (- strand)
Length: 1700
Type: CDS
Source: GLEAN
Position: GCSC_144:1291436..1290240 (- strand)
Length: 1197
>GLEAN_6251 class=GenePrediction position=GCSC_144:1295824..1290240 (- strand)
ATGTCGTCTCACACGTCCGAATCTCTGCTTTCATCTGGACAGATGAAGGTGATATACTTCAGTTATGAGTTGCCAGAAGA
CCTCAGCGGTCTTCTGCGTCGGCTTCATGTTCACAGCCAGTGCAGGAAGCACCACATTTTGGCGCAATTCATAAGCCAGG
CCACGCTAGCTGTGCGCGAGGAAGTCCAGTTGTTGCCAGCCTCACTACGCTGTCTGGTGCCACTGTTTGAAACCATATTC
AGCCTCGCGGGCTACTCGGATCTGAGAAGCGGGCCTCTAGCAGGCTCGATGGACGGTGTTCTTCTCTGTGGATTTCAAAT
CGCAACCTTGATCGGGTGGGCTCTTCCCTACCTCCTGCGTCCATGCGCTTCTAACACGCTACCATAGATACTATGAGATC
AACGGATTCCATGATGTCCACAGCGGAGACAGATATCTTTCTGGCCTCGGTCTTGGTCTGATCTCGTCTTTGGCCGCCTC
GCTAGCCCCTGACTTGGCCAGTCTTCCTACCATTGGCGCTGAGGTGGTTCGGATAGCGTTCCGTTTGGGGGTGGTTGTCA
GCGAGGTGTCAAACAACCTGGAGCCGATATCGGGACAGCCAAGCCACCATCACAGCAGCTGGGCATACGTCGTTCCCGAT
GTGGTTCCTACCGACGTTCAGAATGAGCTTGAGGTGTATCATGCTGAAAAAGTGAGTTCGCTGTCCCTGCAGTTTGAGCA
TCGTGGTTTCTGACTATGGCAGAATACACCACCATCCAGCCGGATCTTTATCAGTGCTCTAAGCCGCACATCTGTTACGG
TCAGCGGACCGTCATCCAGCCTGAAGACACTGTTTCTAATGTCTGATTTCTTCCGTGGCCGCAAGTGGGTACATGTCTCT
CATTTCTCTTCTTTGTCGCCATCAATCGTGCGCACTCACACAATCAGGTTCCCTTGCCAGTGTTTGCTGGCCTCTGCCAT
GCCAAGCATATTTACGACAACAGCTACACGGCAGAGATCATCCAGACAAGCTCCATTGATGTCATCGACACCACATTTAC
GCCACAAACGGCCATATTCTGCTCAAGCAACGGCCAGCCAATGCAAGCTTGGACGGCACGGACACTCTTTAGGGACGTCG
TCTCGGAGATCCTCACGCAGTCGATCCACTGGGAAAAGGTGGTACAGGGCATTATGCAGACGGCGCGTGGGACCGCGGCG
GTCAAATTCCAGCTTGCCATATTTCAGCCGTCGCTGGCAGACCACGAATTGATGCACACGCTAAACGCCGAGCTGGTAGG
GCTTAAGACGTCGACGAAGAACCTGGCATCGTGGATCACGGCAGACGATAGCAATCACGAGACCACAGCCAACGACGGCA
TTGCTATTGTCGGCATGTCCTGTCGTCTACCCGGTGGCGCTACGGACACGGACACGTTTTGGGCCATTTTGGAACAGGGA
CTCGACGTGCACCGGACCGTTCCGGCGGACCGCTTCGATGTCACCACGCACTGCGACCCCAGTGGCAAAAGTCTCAACGC
CAGCTGGACCCCGTACGGCTGCTTCATTGATGAGCCAGGACTGTTCGACGCAGCCATTTTCAACATGTCGCCACGTGAGG
CCGTGCAGACGGACCCGATGCAGCGGCTGGCCCTCGCCACAGCGTACGAAGCACTTGAACGTGCTGGCTTTGTTCTCAAC
CGTACACCTTCGTCGCGAGAACCCTGTGTCGGCACATCCTATGGCCAGGCTAGCGACGACTACCGTGAGGTCAACACGGG
TCAAGAAATTGGCACCTACTTCATCACGGGTGGCTGCCGCGCGTTTGGCCCTGGGCGCATTAACTACTTCTTTAAGTTTT
CCGGACCCAGCTATAGCATCGACACGGCGTGCTCGTCGGGGCTGGCGGCCATCCAGGTGGCGTGCACGACGCTCTGGGCC
GGCGACGCAGACACCATTGTAGCCGGTGGTGTCAACGTGCTGACCAACTCGGACGCGTTTGCCGGCCTCAGCAATGGGCA
CTTTTTGTCTAGTACGCCTAATGCCTGCAAGACGTGGGATAGCGAGGCCGACGGGTACTGCCGTGCAGATGGCGTGGTAT
CGTTTGTGTTGAAGCGGCTGGCCGATGCCAAGGCCGACAACGACACTATTCTGGGGGTTATTGGGGGTGCTGGCACGAAC
CATTCGGCCGACGCCGTCTCTATCACCCACCCCCATGCGCCCTCACAGGCCTATCTAATGCGACAGGTTCTGGCCCAGGC
CGGCGTGGATCCCCTGGATGTGAGCTACGGTAGGTCCCCTCACAGCGTGAGATGTACATGCGATTCTCCTTCAGTATTGA
TGACTAATTGACAAAGTGGAAATGCACGGCACCGGAACGCAGGCTGGCGATATGCAGGAAATCCAGTCGGTGGCCGACGT
GTTTGCCCCGACCAACCACCGGCGAAGCGCCAAGAGCTTGCTACATATTGGCGCTGTCAAAGCTAACGTCGGCCACGGCG
AGGCAGTCGCTGGCCCTACATCCTTACTCAAGGTGCTGTTGATGCTGCAGCACGAGGCCATCCCACATCGGCATCAAGCA
CCAGCTCAACCCAGGCTTTCCGAAAGACCTAGACAAGCGGCACATGCACATTCCCTTTATAAAAACAGCCTGGCCACGCG
CATTGGGAGATGGCAAGAAGAGGCTAGCTCTAATGAACAACTTTAGTGCTGCTGGTGGCAACAATTGTCTGCTTCTGGAG
GAGGCGCCGGCGAAGACACCTTGCAAAACCAGCGACCCTCGACCTGTCCATACGGTCGCAGTCTCCGCCAAGAGCAAGCA
GTCGCTACTAGGAAACCTCGAGCGCCTAGTAGCCTATCTCGAGGCCCATCCGCAGACATCTATGGCTAACGTCGGCTACA
CTACCACAGCACGTCGGCACCATTACAACCATCGCGTGGCCGTCGTTGTGTCCGATGCCGCTACAGCCACTGCCAAACTA
CGCACGCAGCTGACTTTGGTGGACGCCCTCAAGCCCATTCTGCCCATGGCACCACCCTCGGTCGTATTCGCCTTCACTGG
CCAGGGCGCATCTTACCCTTCTATGAATGTTGAACTGTTCCATGACAGCCCGGCTTTCCAGGCCCAGATGCTGCATCTTG
ATGTTCTTGTCCAGAAGCAAGGCTTTCCTTCTATAGTGCCTGCACTCGATGGCAGTCACGTGCGAAGTCACGTCCATTCA
CCCGTGGTCACGCAGCTGGCTCTCGTCTGTGTCGAAATCGCCCTGGTGCACTACTGGGCGGGACTGGGCATTCGGCCGGA
TGTGGTCTTAGGTCATAGCCTGGGCGAGTATGCTGCGCTGCATGCGGCTGGCGTGCTATCAGCCAGCGATGCCATCTTTC
TAGTCGGCAAGCGGGCGCAACTGTTAACGGAGCTCTGCGAGGTGGGCAGCCATGATATGTTGGCCGTGCGGGCGTCGGTT
GAAGACATTGAAGCGGCCGTGGGCTCCGGTGACTACGAAGTGGCCTGTTTAAACAGCCCCCGGGACACTGTCTTGAGCGG
TTCAGCAAACAAAATCGGCCGTGTCGCCCACGCCTTGGAGACCAGGGGTATCAAGCGCTTCCGGCTCGACGTCTCCTTTG
CCTTCCACTCGTCCCAAACCGACCCTGTACTGGACCGCTTTGAGCAGGCCGCCTGTGCTGGTGCTGTTACCTTCCACCAG
CCCACGCTGCCTGTTATCTCGCCGCTGCTAGGCCGCGTTATCTTTGATGACAAGACAGTCAACGCCCGCTACATCCGCCA
GGCCACACGCGAGCCCGTGCGATTCCATGAGGCGCTGGGGGTTGCATACAATATGGGCATTATCGACGACAGCATGGCCT
GGGTTGAAGATGGCCCCCATCCCGTCTGCCTCGGCTTTGTCAAGTCGACCCTAACTGCGGGCCCGGTGGCTTCGGTCCCG
TCGCTGCGTCGTGGTGAGAACAGCTGGCAGACCCAGGCTCTTAGCCTGGCCGTGCTGCACAACGCCGGGCTGCCAGTCAA
CTGGGACGAGTTCCACCGGCCCTTTGAGCCGATGCTGTCCCTAATGGACCTTCCAACGTACGCTTGGAACGACAAAACGT
ACTGGCATCAGTACACGGGCGTCTGGGCGCTAACTAAGGGCAACACCTTTTACACGGACAAAGCAGAAGCCCAGAAGCCG
CTCAGCCCGGCTAGCTCGGCCATTCAGACAACGTCTGTGCAGCGGGTCGTCCAAGACGTCTTCATGACTACCACTGCCAA
GGTCGTGATCCAGTCCGACCTGATGCAGCCCGAGCTGTTGGCTGCTACTTACGGACATAGAATGAACAACTGCGGCGTTG
TTACATCTGTAGGTCTTGCATTTGTTACTCTGCTCTCCTTCTTTATTTCTCTCCATCTAACTCTTTAGTCTATCCATGCC
GACATTGCCTTTACGCTTGGCCGCTACCTGCTCGACAGGCTGCGCCCAGGTGCGCAAGACACCAGCATTGATATTGCCAA
TCTCCAAGTGGTCAAGGGTCTTGTTGCCTACAAAGACACTTCAGTCCCTCAGGTCATCCAGGTGTCTGTGGTTGTTGATG
ATGTTTCGACACTTTCCGTAGCTCGGCTAGCATGGCACAATGTCCAGGCAGATAAGACTTTAGAAGAGCTTCCCTTTGCC
ACAGCCGAGTTGCACTTTGGGTCCCCCGCTGGCTGGCTACAGGCCTGGTCTCCTTTAACTCATCTCGTCCAAGGTCGCAT
TGACGAGCTCACCCGCCTCGCTGATCTCGGGGTAGCCAACCGCCTGTCTCGTAACATGGCCAACACGCTGTTCGCTGGCA
GTCTGGTCGACTACAGCGAAAAGTACCGCGGCATGCAGTCGGTTGTCCTGCACGGTCTGGAGGCATATGCCGATGTGACG
CTGTCGACAGCCTCTTTGAAGGGCACCTGGACCATCCCGCCCGACTTCATCGATAGCGTGGCCCACCTGGCCGGCTTTGT
CATGAACGTGTCCGACGCCCACGACACGCACGCCAACTTTAGCGTCACGCCCGGCTGGGGTTCTATGCGGCTGGCCGTAC
CGCTTGTGGCTGGGGGTCAGTATCGCTCGTATGTGAAGATGGTCCCGACCTTCGAAGACCCGCGCATCTTCCTAGGTGAC
GTTTACGTGCTACGTGCTTTAGACGGGGTTATTATTGGTGTCGTGGGTGCCATTGAGTTCCGCCAGTATCCGCGTCTGCT
ACTAAACCGCTTCTTCTCGGCCGATGCGCCGACTGCCTCGCCTGGATCGGCTCAACAGTCCACCAAGCCTGTTGAACCTG
TGGCCCCTCCTCCTGTACCTGTTGTTCAGAGCACATCTGCACCAGCGCCGGCAGTTGCGGCAGAGAACAACACAGATAGC
ACGACGTCCAAGGCCATTGCCCTGGTGGCTGCCGAGGCTGGTATTGAGCTTTCTGAGCTGCAGGATGATGTGCACTTTGC
CCATGTCGGTGTTGACAGTCTCATGAGTCTGGTTATTTCCGAGCGCTTCCGCGAACAGTTGGGCGTGCAGGTCCGGGGCA
GCTTGTTCTTGGAATATCCGACCGTAGGTCACTTGCGGGCGTGGTTGGCTGAGTATTACGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62