GenePrediction:GLEAN_6252 Details

Name: GLEAN_6252
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1288969..1287315 (- strand)
Length: 1655
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1288969..1288324 (- strand)
Length: 646
Type: CDS
Source: GLEAN
Position: GCSC_144:1288261..1287315 (- strand)
Length: 947
>GLEAN_6252 class=GenePrediction position=GCSC_144:1288969..1287315 (- strand)
ATGTCTGGATCGATCTCGCCGGGTGGCCTGACGCGGCCTGACGAGCGGAGCGCCCTGCTGCCCAAGGTCGCCTCGGCCGG
TGCCTCGTCTGAGCGGCCGAGTGTGACCGGTGATGGCTATGGCTCGGATGGTGACGACACGACGGCGGCAGCTTCGTCGG
ATGAGACGACCGAGACGCCGTACCGGCTGTGGCTGGCCGAGATCTGGCTGCTGACCAAGGCGTCGGTGCCGGTGATCCTG
GCCTACACGCTGCAGAACTCGCTGCAGACGGTGTCGGTCCTCATGGCCGGTCGGCTCTCGCCCGAGGCGCTGGCCACGGC
CGCCTTCTCGTACATGTTCGCCATGGCGACGGCCTGGCTCATCGGACTTGGTGGCACGACCGCCCTGGACACGCTGGCTT
CGAGCAGCTTCACCGGCTCGGCCAACAAGCACGACCTCGGCATCCTGCTGCAGCGCGGGCTCGTCATCCTGTCGGGCTTC
TATGCCATCGTCTCTGTGCTCTGGTGGTTTTCCGAACCCGTCTTCCGTGCCCTCGGCCAGGAGGAGTTCATCTGCGTCCA
GAGCGCCATGTTCCTGCGCTGCCTCATTCCCGGCGGCCTCGGCTACATCTGCTTCGAGGCCATGAAGAAGTATCTGCAGG
CACAGGGTGAGTCTCCTTTTTCTCTTGATTCTTTCCTTTGTTTTTCTCACTTCGCCTAACTTTTCCAGCCATCTACAACC
CCGGCACGTACGTGCTGCTCATCACGTCGCCCCTGAACGCGCTGCTCAATTACGTCTTCATCTACGTGCTGGATATCGGC
CTGTACGGAGCGCCGCTGGCGACCGGCATCGCCTACTGGACGTCGTTCTTGCTGCTGGTGGCCTACGCCGTCTTTGTGCG
CGGCCACGAGTGCTGGGGCGGCCTGGACCTGCGGCGGGCTCTGCACCCGGAGCACATGCTCCCGTTTGCCCGCCTGGCCG
TCCTCGGCATTGTCCACGTCGGCACTGAGTGGTGGGCCTTTGAGATCGTCGCGCTGGCCGCTGGACGTTTGGGCACCATC
CCACTGGCTGCCCAGAGTGTCATTATGACGGCCGACCAGATCATCAACACGGTGCCTTTTGGTCTCGGCGTCGCTGCTTC
GGCTCGCATTGGCAACCTGCTGGGCGCCCATAAGCCGGCCGAGACCCGGCGTGCGGCCCATTGTGCTGCCGTGCTCAGCA
CCATTGCCGGTTCTCTCATCTTGGTCATCCTCATGAGCGTGCGCCACGTGTTTGGCCGCCTCTTCAACGACGACCAGCGT
GTCATCGACCTCGTTTCCGCCGTCATGCCCTATGTCGCCCTCTTCCAGATCGCCGACGGACTCAACGGCAGCTGCGGTGG
CGTCCTGCGTGGTATGGGCCGCCAGTGGGTCGGCGCTGCCGTCAATCTCATCAGCTACTACGGCGGTGCCCTACCCGGTG
GCATCTACCTCGCCTTCCACGGCTGGGGTCTCGGCGGCCTCTGGATCGGCCAGTGTGTCGCCCTCTATCTCGTCGGCGCC
TTTGAGTGGGTCATCGTCGGCCTGAGCGACTGGGACAAGGAGGTCGACCGCGCCATGGACCGTCTGCGTGCCGGTGGTGT
CGGTGTCTCTCTGACCGCCGATGACGACGACATTGACGAAGCTGCTACTGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62