GenePrediction:GLEAN_6253 Details

Name: GLEAN_6253
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1270560..1266829 (- strand)
Length: 3732
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1270560..1270453 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_144:1270296..1269893 (- strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_144:1269715..1266829 (- strand)
Length: 2887
>GLEAN_6253 class=GenePrediction position=GCSC_144:1270560..1266829 (- strand)
ATGGACCCTCCAAGCAAGCGCCGTCGACTGGCGCCGAAACTCCCCGGCCCTGTTCCGCCTTCCCAGAACCACCAGCCCAT
ACTTCCTGCCCGACCTACCCCTGAGCAGGTGAATAACTTTCCCGGAGACAGCCTTGTCCTACTCAATTGATGCTACCCGA
CAAACTTCCCTCCCCTCCACCCCCTTCACTCTTTTGCCGCACGCCATCTCCGATTATCGCGCTTCCACTCGCCTTCACTA
ACCTTGCTCGCCGTCTGCTTCTAGGCTCCGTCGACGAACCCTCCGAACCAGCCTGCCCACGACACGCCCTCACCCACGCA
TCCCGAGAGACATGAGTTCGAGACCTTTGCAAAACACCTGCAGGATGCCGCCATGTACATCTACCGCCAAGGGCAACGCC
CCCCCTACGCGCATGTGTCGGCCCTCCTGCTGAAGTGGGACGACGATGTCACCGCCTCGGCGGATGTCTCCTCCATCGAG
CGCGTCCTTCGCGACCGCTACAATTTTCACACCGAGCGCTGGGGCATTCCCGCCGTCGCCAATCCGTCCCCCAAGCTGAT
TGCGCGCATCGCCGAGTTCCTCAACCAGGCTGGTGCCGATCATCTGCTGATTATCTACTATGTCGGTCATGGCTTCGTTG
GCCCCGATAGCCAGCTGTACTGGGCCTGGTGAGCATGCCTTGCCTTTCTTTGATGCATACTTTATTTTGCTCGTTATCTC
AACCACCCTGCCATCCGTTCATTCTGCCTCCTTTTTGCTACTTTTGCTCGGAGCTTGCGCGTCCCGCTTTGCCACGCCAC
AGCCAGCCAGCTGTTCGCCGATGCGCTAACCAACACCAACTCTAGTAATGCGAGAGAAGACTCACCCAAGCTCAGATGGG
ATGGAGTGCGCTATCTCTTTGACGATGCGCAGTCTGACATCTTGCTGCTGTTGGACAGCTGCGCCTCTAAGGATACACCT
GTCGCCGGCAGCCACGGTGCCAAGCAAGTCATAGCCGCCAGCACACCCGAAACCAGCCCCCGCGAACCCGGCGGCCGAAC
CTTCACGTCCTACCTGACCGAGGCCCTGCACAGCCTCTGCAACGGCCGTGCCTTTAACGTGCAGCGGCTGTACGACGAGA
TTCTGGCCTGCCAGCACCATCAGGAGAAGCAGTACCCTTCCCGGCCCACCAATGGCGCCCAGACTCTTGCGCATCCCCAT
TTCAGGGCACAGCCTCCTCTTTTCCTCACACTGTCGCCCGGCAAAGACCCAACCATCGATTTGGCACCCGTGCCCAGGAA
CCATCCAAGCCACTCCCCCCCACACTCCTCATCGCAGCACGGTAGCCACTCCGAGGGCAAGGCCCGCAATGGCTTATCTG
TTCTCGAGAGCGAGTCTCCAATAGTCAGCCCTGCCGCCGTGGCCGACCTTGTTTTCGACGAGCCCCGCGTGCTGGTCTGC
ACCACCTTTGTTGGAGATGCCAGCCCCGACATGGCCAGCTTCAAGCAGTGGGTGGCCAGCACGCCTAGCCTGACCTCGAG
AGTGGCTGTCGAAGGCATGTTTCTCGGTCCTCCCACGGTGCTGCTGATATCCATACCGCAGTCGTTGTGGGGTATCATCG
AGAGCCACAACATATGCTTCTCCCTCGGCTATATTAACTCCCGGAACCTGATCCACCTGTACGACGGTCTGATGAAAGCG
GCCACCCTGCCGACATTGGCATCTGCGTTGCATGCGCCGGCACCTGCATCTGCACCACATGTCGCCATGCACGCCTCCCC
AGAGGATGTTGAAGACGGCCGGACCCTTCTTGCAGCCAGGCAGGCGGCTGTTAACAACAGCCATGCCGCCAGCCACATGG
ACGACCATCTACACTCCGCCTACTACCAGCAACACCAGCAGGGGCCGCTTCCTGCCCCATCGCTGCCTTTGCCGCAACAG
TCGCTTCCACCCCTGCAGCATGGGCAGCACTTGCATCACCACCTGCCCCCGCCATCATATCACGAGGGCGGCAGCCCGAA
CCGTTACCAGTCCAACGTCCAGAGGCAAGACCCAATTGCCCCTCAGCAGCATCACGCCCGTAATCAGCAGCATATCCAGC
ATCATCATCAGCAGCAGCAGCAGCAGCAGCAACAACAACAACAACAACAACAACATCATCCTCAGTTTTCTGCGCCGCGA
ACGCCTCTACCTCGCATTATCTCTAGGGCTGGCAGTCCCGTTCCTAAGGAGGAAATTGAGGACTCTGCCGAGATGAAAGA
GGCAGCAGAGGGGCTGAAGGCATTGAGCCACATCCGCCCGACGAACGGCGATTCTACGTCGCCGACGCTACCATCTATGA
CTAGCAGTCACCTCTCGAAGATCGCACAGGACGTCATCAAGTGCCGGGTAGATGCAGCCGAAGCGGATGATGCTGAAGCA
GCAGCGGTCGGCGGAAGCCCTTTACCGAGCAGCAGCAAAAAGGCAAAGGCAAGAAAAGACTACCGTTTTAAGGCGTCAAA
ATCCCATGACGGCCAGGCTACCTCACGGCCCCGCGCCCAGTCTGAACGATCGGCGCAGCCACTGGTACCGCTGCAGCCTC
AGGGCGGCCTGCAGAGTGATTCTCAGTGCCACTTCTGCGACCACGAGCCGTTCAAGGATGCATCGTCTCTTCGGAAACAT
ATCGCTGCCGCACATACGCGGCCGTTTCCCTGCGCCTTCGCCTTTGCCGGTTGCACGAGCACGTTTGGATCTAAGAACGA
ATGGAAGCGTCACATTGCATCCCAGCACCTCTGCCTGCAGTACTATCGCTGCTCCGGTTGTTCGCAGAGTGCTGCCGATG
GCAAAGGCAACGAGTTCAACCGCAAAGACCTATTTACGCAGCACTTGCGTCGCATGCACGCCCCAGTCTACATTCGAAAG
GCGGTGCAGAAGAAGGACGGCAAGGTGGAGTCGGAGTGGGAAGACTACGTTAGGGAAATGCAAAAGACGTGCTGTATTGT
TCGGCGCCGGCCACCACAGCGGGCAGCCTGTCCGAAGCCAAGCTGTGTTCGGCCCTTTGAGGGCCGCAACGCATGGGACG
ACTGGACCGAGCATGTTGGACGGCACATGGAGAATGGCGAGGGCGAGCTACTCGGCGTGGACGACCTCCTGATTACATGG
TCTCTGGAAGAAGGGATCATTACACAAACAGAAATTGGTAGCTATCGGCTATCCAATCCGATGGGCAACGTGGGTAACAA
CGGCGGCTTGATAGGCAGCAGACGCAGCTCACAGAGCGTCAGCGACGGGCTTAAAAGCACGGGTCTCTCGAATCTGTCGG
CGACGTCGTTCCCTTTGGACGCAGATCAGTCTCACGCGAACCGACGGGACGAGAAGCTGGTGATGCCGCCAACACCACCA
CCGACGACAAACCGGCAGCTGAACGAGGAGCAGGCGGAAAGGCACCAACCAGAGCCACCGACAAGAGAGGCACAAGAAAC
TGACAGCGCCAAGGACAGTGTTAGCCAGACGGAGGAGCGGGATATGGAAATGGTCGAGATACAGCAAGCTACACAAAACG
GAGGACAGGACGAACAGCAGGGCAAGGAGGCCGTGTCAGCCAACGGAGAACTGGACACAAAGGCGGCTGAACAGGAAGCG
GAACAGCCAAAATTGGCGACAGTGGTGGAGGAGACAAGCCCACTCACATCGATCACAGTGGCTTCGCTTAATGCTGCTGC
GGCCTTGCAAAAAGAGAAGATGGCTAGCAGTGCGATGGAAGTTGACGGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62