GenePrediction:GLEAN_6255 Details

Name: GLEAN_6255
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1262769..1261012 (- strand)
Length: 1758
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1262769..1261525 (- strand)
Length: 1245
Type: CDS
Source: GLEAN
Position: GCSC_144:1261458..1261012 (- strand)
Length: 447
>GLEAN_6255 class=GenePrediction position=GCSC_144:1262769..1261012 (- strand)
ATGGCCGACGGCCGAGAAGAGGACCTGCTGGACCTGCTGCAGGCGATGCAGGCGCAGCAGACGGCCCTCGCCACCAACAC
GAAACAGCTGCTGGAGCGGTGTCGAGCCGAACATGCCGGCAGCGCTGGCCGCAATGCCGATGTTGACGCCGCAGCAACGG
AGAAGACGGCCGGCCCTTCGGAGGATGTCGCCATGGGCGGCATGGCTGACGCCACAGAGAACAGAAGACAGCCAGGACCA
GGAAGCGAGGACGAGAAGCAGAGCCGGCCGCAACCACCGCCACAGCGGCTGCCGTCTCTCTGTCGGGGCTGCTACGACGT
CTTGCTGACGCTGGTGCACGATGCCTACGCCACGCCCTCCCACACGCAGTGGTATGCCGCCGACAAGGACGCCTTTGCGG
CTGAGCTGGACCGCCGCCTCGACGACGTCCGCCACCTGCGCGACGGCGCCACCCTTGCACGCGTGGAGGACTGGATCGAC
AGCCAGCGACACGCCTGGCTGCGACGCCGTCTGCGCGACGCCGTCGGCATCCGCGCCCTCGACGAGGCTGTCGATGGCAG
CAGCAGCAGCAGCAACAAGACCAGGCTGCAGCTGCAGACACGGCTTGCCAGCCCGGCGACCGATCTCAGCCAGCTGCTCC
GTGAGCTTCTGGACAGACGAAACGGCCGCAAGACCGACGACGTGGCCGCCTTTGTCGACCTCGACACCGCCCTCGGAAGC
GCCCGGAAAGAGGCCGAGACGGCCATACGGAAACTCCAGCTCGAATCCTCCACATCTTCCGCTTCAGCAGCTGCTCGCGG
CGCCATCCTGCGCGACATCCTCTTCGCGCCCGGAACCACGCCGACCGGGTCGGCCGCCCAGAAGCTCGAGCGCGCCCTGC
TCGACGGCTCCGTCGGCCTCGAGCAGGGCCTCCGCGAAGCCGTGCGCACAACCAACACCGGCTCTGCTGCCATCGCTGGC
AGCGTCGTCACCAACGCTGCCGTCACGGCCAAGATCGAAAAACACCGCAAGCGCCTGGCTGAGCTGCGCCGTGCCAAGGC
CGCTCATGAGGCCCAGAAGATGAAGCGCCTTCGGCCGCCTGAGATGCCCTACTTTCTCGAAGGCGACAGCCCGTGCGCCA
CCTGCAGCCGCACCACAATTCCCCAGCAGAGCCCCTTTTGCATCGTCTGCTTCCTCGAGGTCGACTACTGCCTGCGCGAA
AATCACACCGTCTGGTGCTCGCCCTCGTGCATGGCAAAAACTTATGTGCGTTCTTTCCGAAACCCATGCTTGTTTGCTTA
TGTAATCCAACTGACCTGTTTTCTCCGCCAGATCAAGCACTTTGCCGCTGACCATCCATGTGCTGCCGGCGGTCGCTGCT
GTCGCACCACTACCACCACTTCCTCGGCCTCGCGCCAGCAGCACTCCGGTCATTACTTTTGCCGCGAGTGCGTCCTGTCC
TTCAGCATCAACACCTTTTACTGCACCGAGCTCTGTGCCGGCCGCGACTTTCAGCATCACCGCGAGACGGTCCACCTGCC
AAAGCGCGAGATGCGAGCCGATCTTTACGACGACCGCGCCGATCTGTCCTACGGGCCTCATGGCGGCAGCAATGTCGTCG
CCGCAGACGATCGCACCAGCAGACCGTCCGACGAGTACACGGCTGCCAACATCGCGAAGCACGTGCTCTCCATGGACGAG
GCCTTTGCCTCCTGCCAGAAGAAGCACCCTGACTGGCAGCTCGCTGAGACAAAGGTCGAGATCGTCATGGCCTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62