GenePrediction:GLEAN_6258 Details

Name: GLEAN_6258
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1239197..1238309 (- strand)
Length: 889
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1239197..1239111 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_144:1239058..1238309 (- strand)
Length: 750
>GLEAN_6258 class=GenePrediction position=GCSC_144:1239197..1238309 (- strand)
ATGCGATCGCTGTCCGTTGCTGCTGCTGCTGCCTGGCTGCCGGCCTTGGCTGCTGCTCAGTGGTGGTCTGGTGCTCCGTC
GTGTGCAGTAAGTCCTGTTTTCGTCTGTCTCTCTTCCCTCTTCTGTCCTAACATCACAGGCCTCCTGCTTCTCCTCGGTC
TGGTCCTCGTCCGACTGGCCGTCGCCGACAGCCTTCTGTGTCGCCTCTGCCACGCCCATTGCCAGCTGTCTGAGCGCCAG
CTGTGGTTCTGCCACCTCGGCCGCTGCTACCTTCTCGTCCATCTCGTCGTCCCTCTGCAGCCAGTACTCATCCTGCTCGT
CTGGCGGCAGCACCGGCGTGCTCACCGTCACGGCTACCGCTCCCTGGGGTGCCTACGGCACCGGCACCGGCTCCTTTGGT
CCAGGCAGTGGCTTCTTCGGCACCCGCTCTTGGGACTCGGCCGCCACGGCTGTCGCCACCTACACCGTCACCGGCTGTCC
CTGGGACGGTTCGCCCTGGGTCGCCGGGCCTGGCGCTGGTTGGGGCGGCTGGGGTCCTGGCGGTTTTGGCTGGGGCGGCG
GTGGTCCCGGAGAGTTCTGGACCAGCTCGTGGACCGGCTGGTCCTACCACACCCAGACCACCACCGTTACCACCACCTTC
ACCAGCTCCGGCTCCGTCTTCACCACCGCTGCCGTCATCCGCGTCGAGGAGGCCGCTTCCGGTACCCAGACCAGCACCAC
CACCCTGGCCACCAGCACCACTACTGTCACTGCTACTGGCACTGCTGCCACCGCGAGCGCTGCTTCCACCAAGAGCTCGG
CTGCCGGCGGTGATGGCGGAGACTGGTTGGCCGTCAAGGTCGTCGGCCTCGTCCTGGCTAGCATGTTGGCTGTCGTCGGT
ATGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62