GenePrediction:GLEAN_6259 Details

Name: GLEAN_6259
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1233855..1231285 (- strand)
Length: 2571
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1233855..1233082 (- strand)
Length: 774
Type: CDS
Source: GLEAN
Position: GCSC_144:1232986..1232519 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_144:1232457..1231285 (- strand)
Length: 1173
>GLEAN_6259 class=GenePrediction position=GCSC_144:1233855..1231285 (- strand)
ATGGCAAGCGCCTCCGCACCGGGAGCGGCAGCTCCTGCCAGTACGGCACCAGTAGCAGCAGCAGCATCCAAAAAGAAGAT
TGCCATCATGACTTCGGGCGGCGACTCGCCGGGCATGAACGGCGTCGTGCGGGCCTGTGTCCGCATGGCCATCCACCTGG
ACTGCGACGCCTTCTGCGTCTACGAGGGATACGACGGTCTCGTCCGCGGCGGCGACTACATCCGCAAGATGGAATGGGAC
GATGTGCGTGGTTGGCTGTCTGAAGGCGGCACTCTGATTGGCACCGCCCGTTGCATGGCCTTTTACGAGCGACCCGGCCG
TCTGGTGGCCGCCAAGAACATGATCATCAACGGCATCGACGCGCTCATCATCTGTGGCGGCGACGGCTCGCTCACCGGCG
CTGACAAGTTCCGTGCCGAGTGGCCTTCACTGCTCAGTGAGCTCGTTCAGACTGGCGAGCTGACGGCCGCTCAGACCGCC
CCCTACCAACACCTCAACATCGTCGGCCTTGTCGGCTCTATCGACAACGACCTGTCCGGTACCGACGCCACCATTGGCTG
CTACTCGGCCCTCACCCGCATCTGCGAGATGGTCGACTACATCGAGGCTACTGCCTCGTCACACTCACGCGCCTTTGTCA
TCGAGGTCATGGGCCGCCACTGCGGCTGGCTCGCTCTCATGGCCGGCGTCGCCACCGGCGCCGACTTCATCTTTATCCCG
GAGAAGCCGCGTGAGGACAACTGGCGTGAAGAGATGTGCGCCATTGTACACAAGGTACTTTCTTTCTTTCTCTTTTTTTT
TTCCTTTTTTTTTTCTCCTTTTCTTTTCTTCTCTTTGCCCTCTCTCGACTTGCCCGCTCACACAGATAGAACCGCCAACT
GGGCAAGAGAAAAACCATTGTCATCATTGCCGAGGGCGCCCTCGACCGCGAGGGCAACAAGATCTCGTCCGAGATGATCC
GCGCACTGTTGGCCGACAAGGACGGCCTGGCCCTCGACACCCGTATCACCACCCTGGGCCACGTCCAGCGCGGCGGCACG
GCTGTCGCATACGACCGCATGCTCGCCACGCTGCAGGGCGTCGAGGCCGTTCGCGCCGTGCTCGAGGCCACGCCTGAGTC
TGAGACGTGTTTCATCGCCATCACGGAAAACAAGATTGTGCGCAAGCCACTCATGGCTGCCGTCCAGAACACAAAGTCCG
TCGTTGCTGCCATCGAGGCCCACGACTTTGATCGCGCCATGGCTCTGCGGGACACTGAGTTCTCCGACCAGTACAAGTCC
TACATCATGACGACCGCCGTGCAGCTGGACCAGCACATGCGGCTGCCCGAGAAAGAGGCAAGTCTGCCACGTCACTAGAC
GCCAGAGACGTCGTTGCTAACACGCGGGCTGTAAGCAGAGAATGCGGATCGGTTTCATCAACGTGGGAGCTCCTGCCGGC
GGCATGAACGCGGCCATACGAGCGGGTGTGGCCTACTGCATATCCCGTGGGCACGAGCCGCTGGCAATCCACAACGGCTT
TGCCGGCTTTGCACGGCATCACGCCGACTCGCCGCTGCGGTCAGTCCGGCCATTTGACTGGCTCGAGGTCGATGGCTGGG
CCAGCAAAGGCGGGTCCGAGATCGGCACCAACCGCGAGCTGCCGAGCGATTCCGGGATGGAGACCATTGCCAACTTGATC
GAAGAGTACCAATTCGACGGGCTCTTCCTCATCGGCGGCTTCGAGGCCTTCCACGCCCTGTCACAGCTGCGCACGGCACG
CGAACAGTACCCGTCGCTGTGCATCCCGATGGTGCTGCTCCCGGCGACTATCTCGAACAACGTGCCCGGCACGGAGGCCT
CGCTGGGATCGGACACGTGTCTGAACGAGCTGGTCAGCTACTGCGACAAGATCAAGCAGTCAGCGTCGGCCACGCGGCGG
CGCGTGTTCGTGATCGAGACCCAGGGTGGACGGTGCGGCTACGTTGCCACGCTGGCCGGCCTCAGCATCGGGGCCAGCGC
TGTGTACACGCCAGAGGAGGGCCTCAGCCTAGACATGCTCGCGACAGACGTGCGGCATCTTAAGGAGGTGTTTGCCAACG
ACAAGGGCCAGTCTCGGGCCGGCCGGCTGATCCTGATCAACGAGCGGACGAGCAGCGTGTACACCGCCAAGCTGGTGGCC
GACATCATCCGGGAGGAGGCGCACAACCGCTTCGAGGCGCGGGACAGTATTCCAGGTCACGTGCAGCAGGGCGGCGTGCC
ATCAGCCATGGACCGGTGCCGGGCGGTGCGGCTGGCGATCAAGTGTATCGAGCACCTGGAGGCCTTTGGGCGCAACGCGC
ACAACCGCGTGAAGAAGGACCCGACGAGCGCAGCCGTGATCGGTATCAAGGCCGCCAGCGTCGTCTTCACGTCGGTCGAG
GAGCTCGAGAAGACCGATACGGACTGGCCGAACCGCCGGCCGCTCGATGCCTTCTGGCTGAACATGAAGGACGTCGTCGA
CGTGCTGTCCGGCCGGCCACCATACCATCCACCGAAAGAGATCTTGACCGGGCTGCAGGCCAAGGACGCGAAGCGAGGCA
TCATTTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62