GenePrediction:GLEAN_625 Details

Name: GLEAN_625
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1060144..1061755 (+ strand)
Length: 1612
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1060144..1060307 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_97:1060384..1061755 (+ strand)
Length: 1372
>GLEAN_625 class=GenePrediction position=GCSC_97:1060144..1061755 (+ strand)
ATGTCGTTTGAGCCCAGGATTCGCTCCTTTGTAACGGCAGATCCCGGTCTGCCACATCCCAACCCTACAACAGCCTACTG
GCAGCTGCCCATTCACGACACGGTTGGAAAGATACAGTCTCCCGTTCTTCCTGCCGAGACCGACATTCTTGTTATCGGTT
CGGGGTATGGCAACCCCCCTTGAGGACCGGCAGTGACAGTTGCTAAGTTATGTTGGGCATGACAGCATTACAGGATGCAG
TGTCACCAAGGCCCTATTGGAAGACTCGTCATCTTTTCCCGGCGCTCACGTCACTGTGCTTGAAGCCAGAACTCTGGTTT
CTGGAGCTACAGGACGAAACGGTGGTCACTGTGTATCCGCTGCGGGCCACAAGTTCTCAACCTGGGTGGCCGACTATGGC
GTGGAAGCAGCGAAGGACATGGCCCGTTTCAGCCTGAAGAATATGGAGCGTGTGCAGGAGCTCGGCTCCGGTATGTCAGC
CAAGGTCCGCGAAAGAAGCGAGGTCCGGAGGGTCCAAAAGCTCTGTGTGTCCAACGACAAGGCCCTGTGGAAGCACTGCG
CGGAGTCCGTGGCCATGTTTGCCCGGGAGCTGCCGGAGCACAAGGACCACAACCGTATCGTAGGCAAGGCCGAGCTCGAA
GAGGAGTGGGGCCTCGTGGACGTCGTCGGCGGCTATGCCCAGCCGGCCGGTGCGCTTTGGCCTTACCGTCTCTGCACCGA
GATCTTCGCTCAGCTGTTGGAGACGCATTCCGGGCGTCTTGCCATCGAGACCATGACGCCGGCCACGTCCGTGATGGACA
ACGGGGACGATACCAGCCCCGGCTCCCATCGCTACACCGTCTTTACACCGCGTGGGCCGATCAAGGCCCGATGCGTCGTG
TACTGTACTAATGCATACTCAGGGCATCTCCTCCCCCTCCTTCGCGGCAAGATCTATCCCTTCCGCGGACACATGTCCAC
GCAGGCTGTTCCGGAGCGCTTCCCCTCCTGGGGTGCAAGTCGCACCTGGAGCCTCCTGCAGCCGCCGCAGGTCGACCTTG
ACAGCGGCATGTACCACCACGGTCTCTACTATCTGCAGCAGAACGCGATCACAAAGGACATCTTCGTCGGTGTGGAAAAC
CAGCGGATGGACGAATGTCTGTGCTCGGACGACTCGTTTGTGAGTGCAGCATCGCTCCAGGATCTTCCCACCATTCTGCC
ACGGATGTTCCGCGCCGTGCATGAGGAGAGCAAGTCGGCAGAAAAGGGGTTCGATATGCCCAGGCTCAAGGCTATCTGGT
CTGGTGTCATGGGCATGACTGCCGATGGGCTCCCCCTGGTCGGAAACCTTCCTGTCAGTGCAACGGGTCGGACATCCCCG
GGGGGGCAGGAATGGATCGCGGCCGGCTTCCAGGGCTACGGCATGGACAAGTGCTGGCTCACAGGCGAGGCCCTTGTGGC
CATGATGGCAGGAAGAGACGTCAGTTCCTGGTTTCCTTCTGCCTATCTTATCACGGAGGAGAGGTTGGCGAAACGGCTGG
ATATTAACAATGTAACTGACGAGTACGTCCAAATGGAGAAAAACACTCGCAAGGATGGAGACCCATCTGCGGACCGCTTT
GCACATATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62