GenePrediction:GLEAN_6261 Details

Name: GLEAN_6261
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1212475..1209628 (- strand)
Length: 2848
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1212475..1211767 (- strand)
Length: 709
Type: CDS
Source: GLEAN
Position: GCSC_144:1211714..1209628 (- strand)
Length: 2087
>GLEAN_6261 class=GenePrediction position=GCSC_144:1212475..1209628 (- strand)
ATGAGCGGTAGGCCAGCAACCGGACCGCAGCTGGCCACGTCGCCGGGAGCGATGCCCACGGATGTGGAGGTGGAGGTGGA
GATGGAGATGGAGATGGAGCAGCAGCCGCAGTCGCAGCCGCTGTTGACGGTCAGAAGCCAGGGGATGCTCGAGAGCGCGA
CACGACGACCGCACCGACGGCAGCGAGTGGCCGAGGAGGCACGGCGGCGAGCCGTGCGAGCCTGCACGGGCTGTCGACGA
CTGAAGGAGAAGTGCAACGGGCGGCAGCCATGCCAGCGATGTGTGCGCACGGGACGGACGTGCGAGTTTGCGCCAGCAGG
ACAGGCCGGCCCGGCGGCGCAGAAGGCGCAGCAACAGCAGCAGCAGACCAGGGGACCGATGGCTTCGGGTCGAGCTGGCG
ATGGAAGCCGGGGGGCCAGCAGCAATAGCACCGGCACTGGCACCGGCACCGGAACCATTGCGGCCTCGCAGACGACCACT
GCTGATGAACCGATGCGGTCCAGCGAGCGGGTGCAGTACCTGGAGAAGCTGGTGGCCCATCTGCTGGGTGACGTGCCGAC
GGACCTCAACAACCTGCGGCGGATTCACGACCGGATCAGCAGCGCCCAGCGAGCCGGAAGCGGGCCGCGGGATGCCGTCG
GTGACCTGGACGATGTCGCGCTCAAGGACGAGAACTTTACGGTCAAGACACTGACGCAGAGCACAGCGCGTGAGTTTCTC
TCTTCTGTCTTGTTACGGTCACGTGACTAAACAGCAAACAGACTATTCGGGCGAGTTCTCACACTGGAACTTTTCCCAGC
GGCTGCGCCAGCGGCTCGTGCAATTTCTCGGCGGCGAGCCCGGTGGCCGTCGTGAGATCCTCGAGTACTGGCGGGCGACA
CAGCTGCTGCCGTCACCGCGGATGGCGGTGCTGCGCGGCGCTGTCGGGGGTTGTCTACCGCCGCGTCACGTGGCCCATTT
TTTGGCGCAGGTCTATTTCCGATTCGCCCAGACGAACAGCTTCTATGTCGAGGAGCGCTGGCTGCGGGCACGGCTGGCAC
GGCTGTACGACGCGCCGGGCGCTGTGACGAGCGGTGACGCCGCCTGGGTGTGTGCGGTGCTGATGGTGCTGGCCATCGGG
ACGCAGTTTGCCCACATGGCCGAGGGGCCAGGAGATGGTGCTGGCGTGCCATCCCATTCCCATTCCTATTCCCAGGCACC
CCCCGACGACGTCGGCCTAACGTTCTACCACACAGCGGCACGGCTGATCCCTGATATCATCACGATCGCGTCGCTCGAGA
GCGTGCAGGCCTGTCTGCTGCTGGCACACTACGCCCTCCCACTCGACACGCACGGACTCGCATACACGTATCTCGGGCTC
AGCATCAAGATGGCCGTGCAGAACGGACTGCACCGGCGGTGTCCAACGCCGGCTGACGGCGGCGAGCTGGACGCCTGGAC
CGTCGAGACGCGCAACCGGCTCTGGTGGACGGCCTACTCGGTCGAGCGCCGCATCGGCGTCCTGCATGGCCGTCCAGCCT
CCATCGCGCCCACTGAGATGGACGCCGACCTGCCACGCGATCTGCCCGGTCTGTGCTCGTCGTCGCCGCGCTTCACCAAC
CTGTCGGCCCTGATCGACATGACCGTGCGGTTGAGCGACATCGCCAACGCCATCGGCCTCCTCCGTCGCTGCCCCAAACC
GCTGCAGCCGACCTATTTTGAGCGCATCATCGAGACCTGGCAGAAGATGCAGGCTTGGTGGGCTCTCTTGCCTCCCGACG
TCCGCTGTCCTGATCCGGCTTCGCCCATGTTCCGGCCCAATGCCCACCTGAAGCTGTGCTTCCACCTCGACCAGATGTTC
ATCGGCCGTCCCTTTATCTTTCGTGATGGTGCCGCCGATCGCTCCGGAATTCTTGCCGCCTCGCCTGTCTCCACTGCCTC
GCCTTCCCACGGCTCCTCGTCCCCGTCCTCCTCTTCAAACTCGTCTGCTCGCCCCAGCCGCCGTGCCCTCCTCGTCGACA
CCGCCGTTCAGGCCGCCTACGACGTCCTCGCCCTCTGCCAGCGCCTTCACGAGACCACCGGCCTCGCCGGCGCCAGCTAC
ACCGAGTTCAGCTCCTGTCGTGCCGCCCTGCTTCTGCTGCTCGCCCAGAGCCTCAACGAGAGCCCCGATGAGTATGACCG
CCGCTCCCGCGACGCCATCGCTCGCGGCTGCCGTCTCATGCGTGCCATGGCTACCGGACGCGGCAGCAGCGTGTCTACCC
GCTCTGAGACTTCCGTTGTCGAGGCCCTCGAACATGCTGTCCGCCGTCTGCATGCGGAGAGGACTCAGCGCGCTGCTGCT
GCTGCTGCTGCTGCTTCTTCTTCGACCAACATGGCCAGCGGTGACCCTGTCCACACAACAGCCACCGACGGCCCCCCTTT
TCCTTCCGAAAGCACGCTTCCTCCCGAAGACGAACTCACCGGCAGCGTCGGCACTGGCAGAAACGGCTACGAGATGTTCT
GTGCTTGGTCAGCTCTCGTCAAAAAGCCCGGGGTCGTTGCCTCGGATAGCATCACCTCCAGCGCCGTTGTCGGTCCCAAC
GCTGCTGCTGCTGCTTCAGACTACCGTCACCATTATTATGGCCACCATGGCGATCCCACTGTTGACCCTGTTCTCGCGTC
CTTCCAGCCTGCCACTTTTGGCTGGCTGCCCGGTGTCGCGTCGTCGGCCAGCGTACCCCAACCCCCGCCCATGCTGCCCG
ACACGTCCTTCCTCTCGCCCTGGGACGCTGGCGGCGCTGGCAGCGATCTTGGCATGTCTGACATCATGCAGGCCTTTCCG
CAGGGCATGCTGGACGTACTGGATAGCGGCTGGCCGCGGTTGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62