GenePrediction:GLEAN_6262 Details

Name: GLEAN_6262
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1209330..1208448 (- strand)
Length: 883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1209330..1209085 (- strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_144:1209017..1208734 (- strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_144:1208571..1208448 (- strand)
Length: 124
>GLEAN_6262 class=GenePrediction position=GCSC_144:1209330..1208448 (- strand)
ATGTCGAAAAATGTGGTCTTCGACGTGGTCGGCAGCCTGGTCTCCTACGACCACCTCTTTGACGTGATCGAGCAGCGCTT
TGGCGCCGACCGGCTGCGCGCCGCCAACATCAACGCTCGCCTGCTGGGTCAGTGTTGGATCGAGACGGCCGAGCGCGAGT
ACACCTATCTCAGCCTGTCGGGCCGCTATGCCACCTTCTTCCGCGTCTTCGGCTCGCTCTTCTACCGCATGCTGCGCTAT
GCCGGCGTGGCTGACCCGCACGCCTTCGCGTCCGAGGGACGACGTCCGCTATCTCGTGGCCGAGTGGCGAAAGCTGAAGC
TGCGGTCCGGTGCCGCCGAATGCATCGCCAAGCTGCGTGCTGCCGGCTTCACCGTCTGGTGTCTGACGGCGGGCGACCTG
GCCCGCGTCGGCGGCTACTTTTCCCTCGCCGGCGTCGACATGCCGTCCGACAACTTGCTCTCCTGCGACAGCACCGGCGT
GGCCAAGCCCGACCCGGGCGCCTACCGTCCGCTGCTCGCCCAGCTCTCTGCCACCGGCGCGACGCCCTGGTTTGCTGCTG
CCCACATGTGGGATGTGTCCACGGCACGGACGATCGGGTAGGTTGTTCTTTGCTGTTCTTATCGTTTGTTTTCTTTTTTC
TTGTTTCTTTTTTCCTTCCTGTTTTTTCTCCTTCCTTTTCTTTCTTCTTTTCTCTTTCTCCCTTCTCTCCTCTTTCCTCT
ATTTCTTCCTCTCCTTTCTGTCCCAGGACTGACCTTTAGCTTCCGTGGTGCCTACTGCACCGTGCTCGAGGCCGATCCCA
TGCACGACATCTTTGGCGACATGGATGTCATAGCACACACGCTGCCCGAGATGGCCGACATGATCATTGCGGCAACACCA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62