GenePrediction:GLEAN_6263 Details

Name: GLEAN_6263
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1208012..1205147 (- strand)
Length: 2866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1208012..1206863 (- strand)
Length: 1150
Type: CDS
Source: GLEAN
Position: GCSC_144:1206737..1206506 (- strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_144:1206135..1205993 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_144:1205925..1205147 (- strand)
Length: 779
>GLEAN_6263 class=GenePrediction position=GCSC_144:1208012..1205147 (- strand)
ATGGCTCCCTCTCCACTGCCGGTCCCCGGCTCGACGACGTCCTTCTGGAGGACTGATCCGCTGCCGCTCGACAACCATCG
CAGCACACCCGACCTGCCAGCCGAGGTCGATCTCGTCGTCATTGGCGCCGGTTATGCGGGCGCCTCCACCGTCCACCACA
TCCTCAAGACGTGCCGGGACCGCGGTCTGGCGCCACCGTCCATCGCCGTGCTCGAGGCCCGCGAAGCCTGCTCAGGCGCC
ACCGGCCGCAACGGCGGTCAGCTCAAGCCCGACCCCTACTATCGGCCCATTGCCATCGTGCCGACCCATGGCCTGGCCAT
CGCCGCCGAGTGTGCCAACTTTGAGGCTGCCCACGTGCCGGCCATCAAGCAGCTGGTCGAGGACGAGCAGATCGACTGCG
ACTTTGTCCTGACCCGCTGCTGTGACGTCTTTCTGGATGCCGACCACTGGACCCGCACGCGGACGGCCCTCGAGCAGCTG
CGTGCCCACAGCAGCCCTGATGGCCTGCCGTCGCTGCGGGACCTCTTCGTCGTCGCCGATGCGGCCGATGCCGAGCGCCT
CTCCGGCGTCAAGGGCTCCCAAGGCCTCGTCACCTACTCGGCCGGCCACGTATGGCCCTACAAGATGGTCCACGCGCTGC
TCAGCAAGGCCGTCGCCCAGGGCGTCAACCTGCAGACACATACGCCCGTCATCGCTGTCGCCACGCCCGACGGCCCTGAC
GGCCCCGTCTTGCTCACTACGCCGCGTGGCTCTATTCGTGCTCGCCGCGTCGTCTACGCCACCAACGGCTACACCTCGTC
TGTCCTGCCCGAGTTCGCCGGCCGCATCGTCCCCTCGCGCGGCATCTGCAGCCACATCGCCGTGCCCGGCACCCCGTCCG
CTCAAAAGTCCCCCCCGCCTCTATCTTCTACCGTGTCGGCTACCTCGGGCCCCTTCACGCGCCCGGCTCAGCTCGCTCAC
TCGTACATGGTGCGCGCCAACTCTGTCGCCTACGAGTACCTCATCCCGCGTCTGGACGGCGGCATCGTCGTCGGTGGTGC
CCGCTCGGTCTTCATGAACGACCTCGCCAGCTGGTACGACAACGTCCGGGACGACGAGATCATCGACAAGGCCGCCCACT
ACTTTGACGGCTACATGCAGCGCCACTTCTGTGGCTGGGAAAACAGCGGCGCCTACACCTCCAAAGTCTGGACAGGCAGT
AAGTCTCTTGTCTTTTTTTTTCCTTTTTTTGTTTTTCCTGCCGTCTCTCTCATTCTCTTCAACTCTAACAACCAGTCATG
GGATACTCCACCGATAATATGCCACACATCGGCGCCATTCCTGGCCGCCCAAACCAGTTCATCATCGCCGGCTTCACCGG
CCACGGCATGCCCCAGGTCTTCCTGTCGGCAAAAGCCGTCGCCGCCATGGTCCTGGACGACGTTCCCTTTGAGGCTACCG
GTGTGCCGCGTCTGTTCAAGGCCAGCCAGGAGCGGCTAGACAGCACCCGCAACCAGGTCTTGGAAATGTGGGAGAGAAAC
ACAAAGGCGTCTGCGAATTTGTAATGAATAGGACCAAGCATTAATTAGCGTATTAGCCAGAGCATGAGACAGGCAGAAAG
CCAACAGATAATATGAGCCCAGCCTCTTATAGGCATATGGGGTGAAGCTCGCGTAATGGAGTAACCGGATATGCAATTAT
CCGCTAGCAAGACGATCTGCCCCGCTATATCGATGAGAGCAGTTCTGATTTTCGGCTCGGACGTGAGCCAATCTGCTTTG
CTATATTATTCTCCAGCACGCTTTGATCTCCTCGTTCCCACAACCGTTAGCGATCACGCAGACACAATTCACATACAGGC
TTGTATTCCATTGTGAGCCTCCGCCTGCTGCCTTCAGAACTGCTGGCTGTCTCACAGCTCCCTCAACGACTCGCGTACAC
TTTGCTCTCCTACCACTTGCCATGCATGCCACCTTGAGTCGCCCGGCCAAGGGTTTCTGGGGCCGGAGCTTCGACGAACT
ACGACGCCTTACGGGAATTGGTACGTTGGCCTCCTGTCCGGCTCTGCCTCTGCTCCTGCCAGGGCTGACCAGCCTGCGCA
TCCACAGTCGTGCGCTTTGAGGGCATCAAAGGTCCGTCTGGCCCCTACCAGCTGCAGTCTTTCCGAGATGCCGCCTCGCT
CGACGACTGCAAGATCATGACGGACGACGAGATCGGCGGCTTTTCGACAGCCCAGATCGACTGGGTGCCTTCCACCTCCT
CGTCCGCGGGCTACGTCCGCTTCCACGGCTCCATCTCCACGCGCCTGCCCGACGATCGACCGGATGTGAAGCGTACCGGC
TACGCCGCCTGGCGCACGGCTGACCGACTGCCCACCGTCTTTGGCCGCTCCGTCTGGAACGTTGACTCGTACGCCTACCT
CGCCATGCGCGTCCGCTCCGATGGCCGCAGCTACCTGATCAACGTGCAGACCGATTCCATAGTCGCCCCGACCGACCTGC
ACCAGCACCGCCTGTTTGCTCGCCGCCCGGGCCAGTGGGAGACTGTCGTCGTGCCCTGGGGCGACTTTGTCCGCACGAAC
CACGGCTTCGTCGTCGAGCCGCAGACCGAGCTGCTGCGCCAGCGACTGCGCTCCGTCGGCCTCGGCCTCACCGACCGCGT
CCCTGGCCCCTTTGAGCTCTGCATCGCCGGCCTGTGGGCTACCAACAACCCGGAGGAGGCCGAGCACGTCGAGGCCGTCC
AGTTCCGCGAGGCTGAGGAGGCCCAGGAGATCCAGGAGACCCAGGAGATCCAAGAGGCCGCAGCCGGCCGTCTCAGAAAC
AAACACGGCCGTCCGGTGCGATGGGACTCAGCACCCCTGCCCCAGCCACAGCAGAGCGCACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62