GenePrediction:GLEAN_6265 Details

Name: GLEAN_6265
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1193993..1192969 (- strand)
Length: 1025
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1193993..1193958 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_144:1193887..1193863 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_144:1193798..1193742 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_144:1193680..1193509 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_144:1193449..1192969 (- strand)
Length: 481
>GLEAN_6265 class=GenePrediction position=GCSC_144:1193993..1192969 (- strand)
ATGTCGTCCATTCCCTCGATCCACGGCCACAGCGCGGTAAGTCTGGAACTGGATGCCTGCCCCAAGTTACCTCGTCCGCT
TAGCTAACTGTCTGGTCGCCTTCCAGGCTTGCTGCAACATCCCCCCCATTGGTACGATGCCAATGCGCATTCTCCAAAAC
TGCCATGCTGCTGACTGACTGGCCAACGCCTACAGTGACGGATGGATACAAGGCCCAAGGAACATACGAAACCATCGGCG
GCAAGAAGACCTGTGAGTCTCAACGGCGCCACGAACCGACATCCGCTTGGATCTCCGCACTAACACGGTACAGATACCGT
TGGCCCCGATGATGCCACCAAGGCCATCGTCTACATCTTTGACATCTTCGGCTTCAAGAACCAGTCCATCCAGGGTGCCG
ATATCATTTCCAGCAGCGATCACCACAACAACTACAAGGTGTTCATTCCGGACTGGTTCGACGGCGAGCCGTGCTCTCTC
TCCATGTGGGTGCATCCTACGGACGTTGTGATTATTTGACCAGTCTGCTGACCTCTATCGCCAGCTTCCCCCCCGACACA
AAGGAAAAGAAAGAGGCGCTCGGCGCTTTCCTGACGAAGAACGCCCCGCCCAAGAACGTCGAGCCTCTACTGGCCTTTGT
CAAGGTGCTGAAGGAGAAGTACCCGACCATCAAGTCGTACGGCGTGGTCGGCTTCTGTTGGGGTGGCAAGGTTGTCTCCC
TCGTCACGTCCAGCGATGAGAACCCGTTCGCCGTCGGCGCTGAGGTGCATCCGGCCATGGTCGACCCCTCGGATGCGACC
AAGATCAAGGTGCCGCTGATCATGCTGGCTTCCAAAGACGAGAACGCCAAGGACGTGGCCGACTTCGAGAGCAAGCTGAC
CGGACCGCACCACGTCGAGACCTTTGCTGACCAGATCCACGGCTGGATGGCCGCCCGGGCCGATCTGTCTATCGAGCGCA
ACAAGGCCGAATATTCGCGTGGCTACAAGCTCCTGGTTGAATTCTATGGCAAACACCTGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62