GenePrediction:GLEAN_6267 Details

Name: GLEAN_6267
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1189121..1187768 (- strand)
Length: 1354
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1189121..1188919 (- strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_144:1188848..1187768 (- strand)
Length: 1081
>GLEAN_6267 class=GenePrediction position=GCSC_144:1189121..1187768 (- strand)
ATGGCAATGGCTCGACCAGCGCGGCTCGCTCTAGGGTTCGGGACGCGGAATATTCCATTACACTACCGGCCAACAGTCAG
TAATGTTTTGGCACGGGGTCCCCGGACGCAGACTGGCGCTCGATTCAAATCTGGGCCGTACGGCTATACTCAGGCAAAGG
CCTTGGTGTTTTCCAAGTTTGGCGAGCCGTCTGAGGCCCTGAGGTGAGCGGGCTGCTGTCCAGTTTCTTGTACGGCACTC
TGATTGCTGATTCGAATCATTTTTTGCATGCAGCCTCCACACGCACTCCATCTCCCCCACACTACCACCGAAGGCGGTGC
TGGTGCGCAACCTAGCGGCGCCGATCAACCCGGCAGACATCAACACGGTGCAGGGCACGTACGGTGGCAAGCCGGCGTTC
TCGTCACTGATCGGGACGGCGGAGCCGTCGGCGATTCCGGGCAGCGAGGCCTGCTTCGAAGTGGTGTCAGTGGGCTCAGA
GGTGACGACGCTGACAGCGGGTGACTGGGCGCTGCCAGCAGCACCGGGACTGGGCACGTGGCGGACACATGCGCTGGTGG
AAGATGCAGACACGGCGCTGGTGGGCATCCCGGCAGCGAAGACGGCTGGTCTATCGCCATCGGCGGCAGCGACGGCGACG
GTGAACCCGTGCACGGCATGGCGGCTGCTGCGCGACTTTGTGGACGTGGTGGAGCTGAGCGTGCGCAGCGGCACCGGAGC
GGGCGCGTGGTTCATCCAGAACGGGGCCAACAGCGGCGTCGGCCGGGCGGCGATTCAACTGGGTCGGCTGTGGGGTCTGC
GCAGCATCAACGTGGTGCGGGCACGGTCGACGGTCGAGGAGACGGCAGCGCTGCACCAGGAGCTGACGGACCTGGGCGCT
ACTGTGGTCCTGACCGAGGACGAGGTGCAGGAGCGCGGCTTTGCGGCGCGGCTGCGCCAGGACTACATGGGCGGCGAATC
TGAGCGCGACAGTCCGCTGCTGCTAGGGCTCAACTGCGTCGGTGGGCGGCCAGCTCTCGGGCTCGCCAAGTGCCTCTCGG
ACGGCGCCAAGGTGGTGACGTACGGTGCCATGGCCAAGCAGCCGCTCACGGTGCCGGCTGGCATGCTCATCTTCCGCGAC
CTCTCTTTTGCCGGCTTCTGGTTCAGCCGCTGGGGCACGGTCAACCCGGGCGGCCGCAAGCAAACCGTCGAGGCTGTGCT
CGACCTGATCCGCGACGGCAAGTTCCATCCCGGTCCTGCGCAAGACATTCCCTGGACCTGGGACACGCCGGTCGAGACAC
TCACGGCGGCCGTCAGCGGCACGCTCGAGGGCTACCGGTCAGGCAAGGGTATCTTCGTGTTCAAGGACACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62