GenePrediction:GLEAN_6268 Details

Name: GLEAN_6268
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1186213..1180052 (- strand)
Length: 6162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1186213..1186038 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_144:1185973..1182868 (- strand)
Length: 3106
Type: CDS
Source: GLEAN
Position: GCSC_144:1182778..1180052 (- strand)
Length: 2727
>GLEAN_6268 class=GenePrediction position=GCSC_144:1186213..1180052 (- strand)
ATGGCGGCATCGGACCTGGACGGTCTGGACGAGTCGGACGGGTCGCAAAGGTCGAACAAGATCATCAAATCGGCGTTTGA
CAGCGACAGCTTTGACTCTGATGGAATCATTCACGCCGGGGGGTTGAAGGGCTCGGCGACGATCTCGCCCTGTGGACGAG
ACGTGGCCGTAGCATCGTGAGTTTTCTGTCTTGTTGATGTTCTTTGATATGGCCTCGTCTGGCTGCTGACAGCAGGCCAG
GCCCGAAGGCCTCGCGATCATCGACCTCGACAATCCGTACAGCGCGCCACGGATGCTCAAGAGTCACGGGATGCCATGGC
TGGTGGTGGACGTGCAGTGGTCACCGTTTGCGGCACGGGACTACTGGGTGGCATCGACGGCAAATCATCGGTGCCTGGTG
TGGAACCTCAACCGGGCAGACGACTCGAGTGCGGGCTCGGTAGAGCACTCGCTAACCGGCCACCGGCGGTCGATCACGGA
CGTCAACTTCTCGGCACACCACCCGGACATGTTGGCGACCTGCTCGGTGGACGGGTATGTGCACTGCTGGGATCTGCGGC
GGGCTAACACGCCGGCACTGACCTTTATCGACTGGGCGGCGGGGGCGACGCAGGTCAAGTACAACCGGCAGGACGAGCAC
GTGCTGGCATCGTCGCACAACCGATGCGTGCACATCTGGGACGACCGGAACCCGGCGATACCGATGCGGACGATCGAGGC
ACACACGTCCAAGATCTACGGCCTGGACTGGAACCGCACGCGCAGCACGTGTTTAGTGACGTGCTCGCTGGACAAGACGA
TCAAGTTCTGGGACTATGCCAAGCGCGGCCACGCGGCCGTGGGGGGCACGCGGACCAGCCTATCGACGCTGTCGACGCTG
TCGGACCTGGTGGACTTGTCGGCGAGCGGCAGCATGGGAAGCGGCGGGCCGATCAACGATGACGACGTGCCGGAGCGGGT
GATCCGCACGCATTTTCCGGTGTGGCGCGCCCGACACACGCCCTTTAGCGGTGGCCTGCTGGCAATGCCGCAGAACGCAC
CCGGTCACCTGTACCTGTACGATGCGCGGCCGACGGCGGCCCAGCAGCAGACGGAAGACCCGGCGGCAGCCAACGAACCG
GTAGCGGTATTTGGCGGCCACGGACACCACAAGGTCAAGGAGTTCCTCTGGCGGACGCGCGGCGAAATCGACAACGACGG
GAGTGACAACCGCGAGTACCAGCTAGTGTCGTGGGGCAACGACAGCAAGCTAAGGCTGCGGCGGTTCGACGGGCCTGACC
TGGCCACGGTGGGCTTTCATCGCGGACAGCCGGCGCCGAAGAACCTGAGCATCACGCGCAAGGGAGCGGCGTACAAGACT
TTCCGCGTGCTGGAAGACCTGGGCGATTACGAAAAGCGGAGCGCGACGATGAGCAGCGTGCGGCCGTACAGTCGGCGTGA
AGCATCTGCGGCGGTGGCAGCAGCAGTAGCAGCAGCCGCAACGGCGACGACGACGACGGCGACGGTGACGACGATGGCTG
GAGCAGCATCGTCACCACCGCCACGGGCACTGCTGCCGCGAACAAGTTCGATGCGTGACGTGCTGGCATCGCCAGCGGCG
ACGCCTCGGCGGGGCAAATACGACAAGCGAGCGTCGTGGCGGAACCCATCGATGCGGGCGACAAAGGCGTCCGGACGGCG
AGAAAGGGATCGCAGCAATGCGCAGCTGGACTGGATGAAGGGTGTGACGATGAGTAAGCGACGATGGGACGACGTGATGG
ACGAAGGACACCGGCGACGGGCGTCCAACGAACGGATGGAGGACTCGACAACGATGACGGCAATGTCCGGGATGTCAGTG
ATGTCGGGGCTGACAGGGACGGGAACGGGAACGGCTACAGCATCGCTGTCGTCGCCGCTGCAGCTATCAGCACACGGGAC
GTCGCTGAGCGGTGGAGGCGACTACTACGGAGGCCCAGAGACGATCCAGGAAGAGATTGTGCGGATCACTGACAAGCTGC
CACGGGTGACATGGGAGGAGATCGACATGGACAACCTGTCGCTGACGGCGGCAATGAAGGGACCGTGGGGAGCCGAGGGC
CAAAGCGTGTACGTCAAGGTGCGGGTGGTGGTACCGGCGACATATCCGCAGACGCGAGCACCCCGTTTCTACGTGGAGAA
CAGCTCGCTCATGCCGGCAGCGACACAGGACCGGGTGGCAGCCGAGTTGCACGTGATTGGGGCGGAGTTTCTCAAGCGGC
GACGCAACTGTCTGCTAGCAGCGTTCCGGTATCTGCTAGGGGCAGCAGACCTAGGAGCGAGCTTGGCAGTGCTGGAACGG
CCGACGGTGGCATCATGGCTGGCGGGCGAGGGAGCAGGAGGAGGAAGTGGTGGTGGTGGTATTGGAGGGGGAGAAGGTGG
TGGTGGAAGTGGTGAAGTGGGAATCGGGGCCAAAGGAGACGACAGCAGCAGCAGCAGCAGCAGCAGCGGAAGCGACGGCA
GCGATAGCGATATCGACTCGGCCATGGCAGCAGCAGACGCAGAAGCAGCAGCTGCAGCAGGCATTGGGCCGGAAATGCAG
CCACAGGGACCACCACCGCCTCCCCGGAGCTGTGGCGCGCGCTTCAGCCGCGACGGACGGCTGGTGTGCTTCTTCCTGAC
CAAGGCAGGACGGGCGAGCGCGAAGCTTCTGTTTGAGCCACCGCCACCGCCGACAAGCGAAGAGCTGGCCGAACTGGAGA
AGCCGGTCTTCATCGGGTTCGGCCGGGTGCTGACGACGGGAGCCGGCAGCGGACACAGGGGCCGGCGACGGTACAAAAAC
AACAACAACAGCAATCACAGTCCCGGTCACAACCAGTCGGGACGAGCACGATCGCCTTCGCCGTTGTCGCTGTCATCCTC
GCCGTTGTCGTCGCGGTCAGACGGGTCGGACAGCGACTCGGCATACTCGTCAACCTCCTCGTCGTCCTCGTCATCCTCGT
CCTCGTCGGAGACGGCGGGCAAACACGGCAGCAGCGCCTACCAGCAATCGGTGCGGAACATGGTGGACCCGTGGTCGATG
AACATGGGCTTCCAGCGGCGGATTGTGCGGCGGGGAGGCGGCGGCCGGGCTGCCCGACGACGGATGCTGCTGCTGGGTGG
CGGTGGCAGCAGCGACGGCGAGGGTGGAGGGGTTGGCGGAGGTGGAAGCGGAAACAACATTGGTGACGGAGGAAGCGACC
TGATGATGCGGTCAGGAACACTGGATGCCGACCTGGAGCTGCCGCAAGGGCCGAAAAGCACGGTATCGGTGGTGGACATG
CGGTCGTGGCTGCCGTCGAAGCGGGAGCTGGCAAGGGAGTACGCCGTTTTTGGCGATGGAGCAGAGGTGTGTGTGCGCAC
AACGCCGGCGTGGCCGACAAGTACGGAGAGACGGATCTGGGCCACGTGTGGCGATATGCGGCGCTGCTGCTCAAGTCGGA
CGTGCCGCTGCGGCTGGCGACGATGCTGGCGGACGGCGGACGACGACAGCGGTCGGTACTGGTGATTGCACGAGAGGCGA
CGGCAGCAGCAGCAGCAGCAGCAGTAGCAACAACAGGCCGGAGCAGGACCGGAGAGAAGCAGGCCGGACGAACCGGCGAC
AGGCTTGCAGGCCGAGTGAAGTGGGGCCTGCATCCATTGGCACGTGACTTTGTGGACGACCTCTTTGAGCACTTTGAGCA
GCGGGCCGACATGCAGATGCTGGCGATGCTGTCGTGCATCTTTGGCGAGTCATTTGAAGAGGACAGCGTGGCGTATGCGG
AATCGCACATGTCGCAGCCGGACACGCCGCTGCCGATGAAGGCGCCGTCGTTCTCGCTGGACTACGTGCCGACGACGCGC
GGGTTGGTGCACGGGGCGCCGTCGTGGCAGCTGTTGCCAGCCGGCAGCGGTCACGGGATCAGCCACACCAGCAGCAGCAG
CAACACGGCACCGCCGACGGCCGTGTTCTACGACGGGTCCATTGACCCGGACGACGGCAGCGGTGGCAGCGGTGGAGGTG
GTGGTGGTGGTGGTGGGATGGGCGAGTACGACGTGGACGACGACGGCTTTGGCGACTACGACGACGTGGACGGCTATGAC
GACGACGATTTCGGCTACGGCGACGACAACACGACCGTGTGGGAGGATGCAGCAACAGCAGCAGCATCGGCGACGGTGTT
CTCGCACAACAACTCGTACTCGGGCGGCGAGACGCCACCAAAATGGGGAGACACCAACTCAAACGGACTGTCGTCGTCGC
CGCGCTTCAGCCTGGCGGCCAGCCGGTTCTTCCGCCGCGGCAACAACGCGGTTGTGTCGGCTATTGCAGCCAGCATTCCA
CAGACGCTGACGACGCTGTTGTCGTCATCGCCGCAGGATCGGGCTGGAAGTGCCGAGGCGAACACAGGCTCGCACACGCA
CACGCACACGCACACAGCCACGACGATTCCGACACGGCGGATGTCGTCGGCCGCCATGCAGCCACGGCTGTCGCCTCCGG
CCGGCCGCCACCCGCTACCCTATGCAGTGCAGCCGCTGAGTCATGCTTACAAGCAGCTGCTGCTGCACTCTACGTCGGCC
CACCGAGACATTCCCATTCCGTCTCCGGCCAATGGACGGCGGCTGGCAGCGTCGACGTCGACATCGCCGCGAACCGGTAG
TGGCGGAGGGAAGACGGGCAGCAAGCTGCTGTCGTCGTCACCGCTGTCGTCGCAGGATCATGCAGGGCCGGCACGCAAGC
GGCCGAGTCCGGCCGAGACGATCTTTGGCAACCTGACGTCGGGCAACCTGACCTGGGCAGCGTCAGCGCTCTTTGGAGGA
GGAAGCGGAGGCAGCGGAGAGGGAAGAGGATGCGTGACGGTCGGGGGGCCGTCGGATCCAGGCACGGCGGCGACGTCGGT
GTCGGACGACGGGCGACGACGCGAGGACACATTAGCGGCAGCAGCAGCGTCAGCGGCCGTCAAGGGGGCACGAGCGCAGG
CCGAGGCAGCCGGCACGACGCTGGTGGCGGTGGACATTCATGTGCGGACGTGCAACGACCACCTCTTTGACGACGACGGC
TGGATGGTAGCGTCGCTGCTGGGAAGTCCACGGCGGCGACGGCGGCAGTACGCCGAGTACCGGTACGCATATTCGGAGCT
GCTGCAGGTATGGGGAGAGCCGCTGGCCCGGTTGGAGGTGCTCAAGTTCAACGTGTTGCGGGAGGATGCCATGAAGGCGG
TGGGCCGACCGGCCATGGCCAGTGGCAGTGGCGGGACGGCATCGCCGTCGAGCAGCCGACGATCACGGCTGCAGGCAGTA
CGGGACTCAGGGCGCGGGCTGGATGCGGTGGGCGTGTGTCCGCAGTGCGAGATGCAACTGGAGCCGGCCGAGTACGAGAG
CACAGCCACGGGAAGCACAGCCACCGAGAGCACAGCCACAGCCACAGCCACGGCCACGGCCAAGACACACCGACACGCCG
CCAAGAACGGCGGTGCGGTGGGTTCCTGCCAGCGATGCCGATTGACGCGGGCGCAGCTGCGGTGTGTGTACTGCACGGAG
CCGGTGGACGCGTTGTACCTGCCATGTTTTGGGTGCGGCTGCGCCAGCCACCCGACCTGTCTGCGGGCCTGGTACGCGGC
CGGCGAGCGGTTCTGTCCGGCCGGCGACGAGTGCGCGTGCGCGGAGGAGGCGACGAGCGGCCGGGTCGAGAGCTGGACGG
CGATGCAGGCGGAGCTGGCGTGGGGGGGTGGCGCAGGAGGAGGAGGGGGTCTGCACAGCATCAGTGTCCTCGGGCCGTCA
GCACCTGTCAGCACGCACAAGGCCAAGGGCCTGATCGAGCAGGCACGCCAGTCGGCCCACTACGCGGCATCGTCCTCGTC
GGCCTCGCTGCTGTCACCGTACGGACAGCACGCCGGCGGTGCCGGTCGTTCCTCTCGACTGCCGCCGTCAGGCCTGCAGC
AGCAGCTCTACAGCCGACGACAGCAGCAGGAGGAACAGGAGCGACAGCAGCGATTTCCACCCTGGGACGAACGGCCACAA
CAGCAGCAACAACAACAGCCACAATCCCAGCCACAGCCACAGCCACAGCCACAGCCGGCACGCTTCAGCCTGTCGAGTCG
GCTCTTGCGCGGCCCAACACTACTGCGACAGAGCAGCGGCAACCAGCACGACCAGCACGACGGCAACAGACAGGGGGGAT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62