GenePrediction:GLEAN_6269 Details

Name: GLEAN_6269
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1176813..1175454 (- strand)
Length: 1360
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1176813..1175733 (- strand)
Length: 1081
Type: CDS
Source: GLEAN
Position: GCSC_144:1175656..1175454 (- strand)
Length: 203
>GLEAN_6269 class=GenePrediction position=GCSC_144:1176813..1175454 (- strand)
ATGACCGACATGGACATGACCCAGGACAGCTGGGATGGCGCGAACACGGACCAGATGCTGGGCGTGGAGCAGTCGCTCGA
AGATCGGCGGCGGCTGCAGCAGGGTTTCCGCAGCCTGATCAAGCAGACGACGACGGACCAGACGCGATTTCTGGACGCCA
AGGCCGAGGCGCTGCACACGGTGCTGGAAGAGTCAGACACGCTGCTGCAGCGGACCAAGCAGACGAGCGAGGCAGCCATT
GATGCGGCACTGGTAATTCGCATCTCCGAGCTGGCTTACAAGCGGACGACGCACTTTCTGGCCGACCGTGCCGACGACAG
CGGCGTCAACCTGGAGGACTTTGTGTCGCGATGCAAGGACTACATGCAGTTTGGCCGCGGTATTGACGATGAAGGCTCGC
CAGATCTGTCACGGGAGCAGCGACGGCGCCGCAAGGTCGAGGCAGCCGCCCACCGGCAAGGTGGACGAGAGGAGGTGCAC
GACGGGAACGAAGAGGACGAGGCACAAGGAACGGACGACGACGACGACGAGGCCGGCACATCCAGCAGTGCTGCCAAGGC
CGATCTGGACTGGACGCACTTTGGCCAGTACGCCTGTCTGCCGCATGTGCGACGGCCTGGACTGGCACGTTTCTTGCCTC
GGGCCACACTGGCCGGCGACGAGAAGACACGGGTGGTGATGCGCAAGCGCACGGCGGCTCTGCGGCTCAACGAGCTGCAG
GAGGTCCGGCCACAGGTGCTGCGACCCGGCGACCTCAATGTGTCGCAGAACAGCGACCTGACGGCGCTGGCCACCGACAT
CCTGCAGCAGCTGCGGCGCGCGGCCGAGCACGGCCAGGCCAAGGTGCAGCGGGCGTACGAGCAGGCCGGCGGCGACGGCG
ACGACGAGGACGACGAGGCCCTGCTGCGCCGCCTCATGGACCGCTACGGCATCCGCAGCGACGGCGGCGTTGACCTCATC
CGCTTCGCCATCAACCCACGCTCCTTTGCCCAGACAGTCGAGAACTTCTTCTACATCAGCTTCCTCGTGCGCGACGGCCG
TGTCGGCCTGGCCTATGACGACAACGGGCTGCCATCAATTTGTGAGTTTTGTTTCCTTTTTCGTGGGTTTTTCTTCCTTT
TCTTTCCCTCCCCTTCTTTTTCCTAATCACCCCTCAGACCCCATCTCCGAAGAGGACACCGAAACGGCCAAGGACAGCTC
CGGTCCCGAGGAGGACACGCGGAAGCACCAGCTGATCCTATCCATGGACATGGCCATGTGGCGCGACGTCATCGAGACGT
TCAACATTAAGAAGCCCATGATAGCCCACCGCGAAATAGCGGGTGAGAAGCATCCCAACGGCCGGGCCTGGTTCACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62