GenePrediction:GLEAN_626 Details

Name: GLEAN_626
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1064206..1064637 (+ strand)
Length: 432
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1064206..1064373 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_97:1064428..1064637 (+ strand)
Length: 210
>GLEAN_626 class=GenePrediction position=GCSC_97:1064206..1064637 (+ strand)
ATGGAGGGCCCAGTCAGGAAGCCAGCTGTGCCACCAAAGCCGGGAGGCAATGCGATCGGAATCAAGGAAGAGGGCGAGAT
GTTTCTGCACTCCCTGTTGAGCAAAAACCTCGTCGTCAGCACCACCGACGGCCGCATGTTCCGCGGCCAGTTCAAGTGCA
CAGACCCGGTGGGTTTTACTTCTTGTGCTCACCTCATATCGACCTGTTTCTGATGGCCATAGGACTACAACATTGTGCTG
GCACACACCGACGAGTACCGCCAGCCGACGGCCCGGCAGATAGCGGAGCAGGCGAGGCAGGCTGAGCTGGCCGGAAACAC
CGGGAAGGTGGCGGTGAACATGGTCTCCCGGTATCTTGGACTGGTCGTCGTGCCAGGGAATCACGTTGTCAAGGTCGAGG
TCGAGCAGTTTCTCAGCCAGATGCGTAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62