GenePrediction:GLEAN_6271 Details

Name: GLEAN_6271
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1170921..1169124 (- strand)
Length: 1798
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1170921..1170910 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_144:1170845..1169961 (- strand)
Length: 885
Type: CDS
Source: GLEAN
Position: GCSC_144:1169669..1169124 (- strand)
Length: 546
>GLEAN_6271 class=GenePrediction position=GCSC_144:1170921..1169124 (- strand)
ATGGCGCCGTCTGTATGTGGATTCCTTTGCTCTGCTGTCTCGCCATCCGATGTGGACTAACGCCTCTGGTTTGCAGTACA
GGATCAGCACGCAGACGAGACGAGGCGCCCGCAACACGTATCCAGAGCACGACGACTTTGAGGGCCTGCCGGTGCGCCAA
TGGCGCCACGAGTGGATCAACGTCGACCCTCCCCAACCGGCCCACGCAAACGACTCGAAGACGAACAATCGGTGGTCCTA
CGAGCTGCCACACGGCATGCCTAAGGACTGGCAGCTGCTGCCGCCGCATACCCAGGACTTGCTGCGCGCTGCGCGCTCCG
GCATCCTGTACAAGCGCCGCGCCCCGGCTGAGGAGGACGAGGCCGATGCCGACGTGACCGCAGCGGCTGCCACGGCTGCA
GCATCGGGCGGGGGCCCGATGGCGGACGCGTCGAGCTCCGTGGCGGACTTGACGACGGCCGATTCTGCGGCTAGTGGCGC
TGATGCGGCAGCGGCTAAGAAGAAGGGCATCCTGCTGCTGGCCGGACAGGCAACTCCGGCAGCCAGTGCCGTCACTACGG
CCGCTGTCACGGCCCCGGCCAAGGACGAGACTCTATTGTTGCGGGTGTGGAAGCAGGTGTCGCGCGACGTGGAGTCACCA
CTGGCGTCGCATCTGGCCAAGCGCCGCAAGAACACGGTGGTATTGCCGCCAAAGCAGACGGTCGAGATCGCCAGCAGCGC
CAGCGCCAGCGTCACGAGCATGCCGATGCCCATGGTCACCGTGGCCAAGGTGCGCAAGCTCGACGCCGCCGGCAATGCAT
ACGAGCAGACGGTGACGCTGGCTGACGGCCAACAGACCGTTGACGGCGGTGAGATCCTGTCTACCACGCTCGTGCCCGCC
TCCAACCGCGACCTGCCGCCACAGCAGCAGCAGACGACACCCAGCCGCAAGCGCAACCCACCGCCTCGTCGCAAGGGCAA
AGTCGGACGCGGCCGAAAGAAAGGTGTTCTTCCCATCGGTCTGCAGCGCAGCAGACAACAGCACGCAGCAGCGGCGGCAG
CGGCAGCAGCGGCAGCAACAGTGACACCAGCAGAAGCAGGAGTAGGACCGTCCACGGTGGCGACAGAAGGCGCAGAGGCA
GCAGCAGCAGTAGCAGAGGCAGTTCCAGAAGAAAACGGCTCTGCACAGGAGACAGTGCTGCCTGCACCTGCAACGGTAGT
CAAGGAGGAGCCCAGCGGCGATGACAACGGAATCAGCGAGTCACAGGACCAGCCAATGACCGACTTCCTCGAGGAACAGT
CCGAGCCGGCATCGTCGGTTGTGCAGAGCGGCGCTCGGTCAGAGCCGGAGCCAGGACAGCAGGCCGACGATCAGCCGGAC
GTGGCCATGTCGGATCAGCCGGCAGAGGAAGTGGCTGTTCCAGAGCCAGAGGTGGCGGCAGAACCGGAGGCACCAGCAGC
AGCGCCAGAAGCAGAGCTCAAGGTGGAGTCTGTGTCGGCAAAGCCCACGCCAGAAGCAGAGGTCACACAAATTGCAGAAA
CTACAGAAGCTGTAGAGACTGCAGAGGCTGCACCCGTCACAGCACCAGAGTCCACAACAGAGTCCGTGACAAAGCTGCCG
GCAGCAGACCCTGCGCCAGAGGTCCAGCTGGATGCGGAGCCAACAACGATCGAACCTCTGTCCGAGACGCCGCCCCCAAA
AGAAGAGTCGCTGTCAGATAAGGTGGACAGTCCTGCCGCGGCAAATGTGGCTGAGCCTGTGGCTGAGCCCGTGGCTGAAG
ATACCAAGGGCGAGACGCAGCCAGCCAGCGAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62