GenePrediction:GLEAN_6272 Details

Name: GLEAN_6272
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1163216..1162694 (- strand)
Length: 523
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1163216..1163118 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_144:1163034..1162804 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_144:1162738..1162694 (- strand)
Length: 45
>GLEAN_6272 class=GenePrediction position=GCSC_144:1163216..1162694 (- strand)
ATGTCGTTCATCGCCCGCCGCGCTTTTTCGACGTCCGTCCGTCGGCTGTCCTCGGACGAGGCCCTGAAGAAGGATGCCAG
GCGCAACCCCGAGCTGCTGGTGGGTTCCTGGCCCCTTCCTATCGCCGCGTGGGCGACAATTCGCGCCGGTTGAGCTGGAA
ATGGATATTGACCTGTGGGCAGATTCTCGGCGGCGTCATGGTTGCCGTGCTCGGCGGTGCCGGCTTCTACTTTGGCCGCT
CACCCACTCAGGCCACGGCCGAGACCCCCGTGCTCAAGGCCGGCATGCCGTGGGAAACCGGCTCCACCGGCAGCAAGTAC
CGCTACCACCCCGGCGGTGACGCCGGCGCAGACCCCAAGGACGCCCCGAGCGCCGTCAACGTCGTGATCGTTCCGGATGT
CAACCTGCCCAAGGTGAGATTGGTTGGCGTCTCCCCGCGTGCGTACAGAGCAATGCTTACTGACTGCCCAACTCGCAGAG
CCTGCACGACAAGTACAACAAGTGGGGCAAGGACGGCTATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62