GenePrediction:GLEAN_6274 Details

Name: GLEAN_6274
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1142423..1131978 (- strand)
Length: 10446
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1142423..1142374 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_144:1142290..1142255 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_144:1142157..1131978 (- strand)
Length: 10180
>GLEAN_6274 class=GenePrediction position=GCSC_144:1142423..1131978 (- strand)
ATGGCTGACGATACCACGTTTGACCTGGACAATGGTCCTCATTTCAGTGGGTAAGCACTCGACTTCCCCCTTTCTCGACG
TTCACGCACTTCTCACGATGAACTCTACTGACAACCTTCTTTTTGAAATTTAGACTTTTCTTGACGTACATGGTCGTTGC
ATCATTTTTGTACGTCTACTGCACTTTTGGCGCAACGTCCTGATCGAGAACTAACAGACATCTGCTATGATTTTAGGGGG
TTATTTTTCTTGTTATACTTCAACAGAGCAATTGCTTCCTTGGTTTTCTGGGCATTGCGACAATGGACCTGGCGCCGCTA
TGGCATATACATCGACGTACAAGCAATTCAGTTCTCGCTGCTGGGTGGCCGCATATTCTTCGTCGGACTTCGCTACCACG
GAAACAACGAGACCATCCTCATACAGAACGGCCACGTCACATGGTCGTACTGGATTCGGAGAGTCCGGCATATTAACATC
GGCAAGCCAACGAGCGGAAAGGACGTGCGTACAGACGATGTGAAAGGGGCGAACGCCCATGGCCACAGCAAAGCCGAACC
TCAGCTGCCTTGTCGCGTGAACCTGGCTATTGCAGGCTTGGAGTGGTTTGTCTACAATCGCAGTGCGGCATACGACAGCA
TCATTGCAGGGTTGACTACTACACCTGTAGATAGTGGAGAGGAATACAACATCGCAGAGCATGACCACCTGGACCATGAC
AACAATGGAATGCACAAACTGCGAAAACGCCACACAAAAGAGCACGACAACGGAGATAGTTCTAGAAAAGGGAAATCAGA
TGAGAAAGCGACTGGTCTTTCTGAAGAGCCTGATCTTCGCTTCTCATCGGCAGACAGCTATGAGCATGGCGGTGCAGACG
GCGACCGAAGGAAGCCCGGAACCGATGATGCCGACAAAGATGCGCTGCCGGTGGTTCTGCAACTGTTTCCTATTCATTTT
ACATGTGACAAGGCGGCTGTTGTGATGGGCAATGAAAATACGTCCGCAATCCTGATTGTCAAAGCCCAGTCATTGTCTGG
CGAGATTGACGCCGTTGAGACCCAGACGCCCGATCCCTACCGGCAACTTTTCAAGATTCGATTTATACAACCTGTCATTG
AAATGAAGGATAATGATGATTACCGCGAGGATCAAGTCAGCAGGGCAGTGAGGGAAAAGGCGGCGAGGGAAAAGGATATT
GCTAAAGAATCTAGGCCGCTTCCACGGCGGTCTTTTTTCCACCACCAACGTCGTGCTGCTGTTAACCAGCTTCGCAATAT
ACTTCCATATTTTCGGAGATCAGTCGAATCCTTCAATTCAACGAGTCCCGGTTCTGCACAGGAGACTTCAGCCTCTGCCC
ACATGCCAGGTTCTGGCCATTGGCAAGGCTTGTCTAGATATCTTGATGGACCTGACGGCGATGAGAAAACGCGCTGGGCT
AGTACCGAGTACGCAATACTAAATCCCATTCTCGAGAGCCCGGAGGCTGTTTTCACGATGTACTGGGACTCTGTGGGTAA
AGTGACTTCTACTGCGGTCGCTGTTGAAGCCATCCCCAGTGGCCCAGCAAAGATAGAGGAGAAACTACTACCAAAAGATC
ATGAGCACAACATCAACGGCTTTGAGCCCCCGCCAGCATGGGGAATGGCCTTGTCAGTCCGCGGGGGCAGTATAAATTAC
GGGCCCTGGGCTGATCGGAAACGAGCCGAGCTGCAGCGTGTTTTCTTCCCAGGTTTGAGCAAAGATGCAGAGCCAGCAAA
AAATCTTCCAGTCGGCGCCCTGCGGGTTCCAACACAATTCAAGATGTACGTGGAGCTGGACGAAGAGGTGACCCTGCGCG
TTCCTCTCCGCGAGTCGTCAAAGAACTGGCGTTTCAAGAACAAGGATACGAACACAAAGTTTCGTCCGGCGCGAGACAAA
CGCCGAGCTCGTTCACGGTTTAAAAAATCGGAACCTGCTGGTGCCGCACCAAGTCAGCGGCCATATGGCTGGCTTGATAT
AAAAATCGCTGCAAACGCCACCATATCGTACTCCATGGACATGGCGGCTAGCAGTACCGGATTCTCCTCGATTCTTAATC
TTGATTTGCCGAAGGTCGAAATCTCTAGCAGCGTCAATCAACAGGTTCTGTGGCGGTCTGCAGGTCTACAGGTTTCTTGT
GACCTATCGACACCCTTGAAATGGAACGATTTGAGACATTGGCATTTCCACATCTCTAGCCATGAACTGGAGCTGTTTTT
GCTTCGCGATCACGTCTACCTGATAACAGACCTGATCGATGATTGGGGCAGCGGCCCCCCATCTCCTTACTTGGTATTCA
CACCATTCAAGTACTCCGTTAACCTCTGTTTCCTGAACGTCAAGATCTATCTGAATGTCAACGATGCAAACATCATCAAC
AATCCGACAAGCCTGGACGACAACGCCTTCATCATCATCTCCAGTCCTCTTTTAGAAGCAGCTTTGTGTATCCCCCTGGA
CCGATATCGACCTCCGAGTAACGCGATTCCTTTCACTGTCCAGACTGCCTCTGCATCTATCGGACTCCACGTCCCAACCT
GGAACACACAGACAATGTTCTGTCCTTGCAAAGACGTGGGCCACTTGAAGGATCTTCTTGTGGATGGAAAGTATCACTAC
TGCGCGACCACTTCGGCTGGCAACACTGATACCCTGATTCTCAATGTATCTGGCCGGGAGCCAACATTCTGGGCACATGG
GTTCGTGGTGCGCTACTTCCTCAAGCTCAAGGACAACTACTTTGGGGACGACGTCCACTTCAAGACCTTGGAGGAATATC
AGGACAGTCTTCTCCTGAAAGAGGCAAACCCCGAAGCTGAGCTGGCTACTCGGCCTCCCCACAAAAGTTCCAATGACATG
GATGTCGTCCTGAGCGTCCATACAGATGATCCGAAGCTTTTCCTGCCTGCCAATCTTTATTCTGCTTCTCGTCATGTTCA
GCTCACGGCTGCATATGTCGCTGCTGATCTGCGCTTCACAAATTATTACATGGACTTGGATTTTGTGCTGAGTCCCTTGA
GCATGTCCCAGGGCAGCGACAGTGACGATGACAAGTATGCGCCCGATGCTTCTATTGACGCCATGCCTAACACCCAGCTC
TTCATTGATGGAATTCACGTGTATGGTAACCGTCTATTTGGCCTGCCACCTACCGAGCCAACCTATCTCTGTAACTGGGA
TATTTCTGTTGGGGCCGTCTCCGGGGAGTGCACAACAGATTTTCTAACGGCTCTAATGAACGGTGGCAAGTCCTTTGGGT
TCACCTTTGATGATGACGAAAATGCGTTGGTAGCGTTTTCGTCCGTTGTGATGTACGATGTCACGTTTCTTCGCGCCAAC
GTCAAATCTGTGAAGCTGTGGCTCCATCTCGACGAGGCAGCATTCTTGTTGTCCCTTTCAGAGGGCGTCGATGTCAAGTA
CAATGACTGGGCTCGAACTCATTATTCGAAGCGTGCCGACATCTCGATTCCAGACTTGCAATTGTCCTGCGTCAACTTAG
AGTCTGCGATGCGCCATAGATCAAGACTTCATATACCTGTTGAGACAGATGCTCATTTAAAGACTGGACTTAGCATTGCC
ATCATCAGCCGCAAGTTTGATTTCTCAAGCGAGAGGCGAATGCAGCAGAAGCTTTTACAACATGAGGATCAGCGGACTAA
CCGTGTTGGATTTCTCTTGTTGCCAGCTTTCTTGGAGCATGGATTCGTTCCCGACAAGATTGAACCTCCTGCGCAACCTG
TACCATTGGTGCCGCAGCCTGTCACCTCGGCTGACATCGAGGAAGACGGAATCTCTCTGTCAACTGAGAGCATGGCCAAC
CAGTCCCAACGACGTATGCGGCATCAAAAATCACGAAGCTCGTTTCTTTCGGTGTCCGCAACCAGCCAGCGCAGCGTTAT
TCGGGCACAAGGCTCGATACTGTCCTCCTCAAAGTCAAAGCATTCGGCTCAAGATCAGCACGAGTTTAATCCCCTTCCGC
TGATAGAGCCGCAAGCCACTGATCAAAGTGGACATCTGTCAGCTTCGCATAGGCGTGACGTTTCATCATCGACCCGCCAT
TCTGGATTCTACAGGGCGACCGGGGACTTTGCCGATGGCGGATCTCACAAAAGCCCGTGTCGGAACATGTCAGCATTGCA
CAGCCAATTCTCTGCTCCAAATTTTCCACTAGACGACATCAACCCCGATATGAGAGAAGCGACTTTGCTGAGCCTGGAGA
AAGATGAGCAGCCCGTCTATGGGGGTGCTGGCAGAAGGTGTAGCAGCGGAGACAGTTTTGACAGCCTACCCACTGACTTC
AACTTGGGGGATGTCGACCCAGATATGCTGAGTGAAGACAGGCTTCATTCTAGTGTTTTGATCCGAGTCCGCGAAGGTGT
GAGCGCTTTCCTCAACCCAACTTCAGTGAAGCATATCGCCTCCTTGATCTCTGTCCTTGAGCCTCATGGACCTGAAGATA
TTTTGGATGCAGTACAGATGAGCTCGGTGGGCGACATCGCCAGTGCCATCAATCATAGAAATATGAAAGGGCAGATTGCA
GACTTTGCCATTCAGCTCCCAGAGGCCCATCTTCGCCTGCTCAACTGCTCAAATTCGGACTCCGCCAGTTCTTCGAGAGA
CGAGAAAGACCAATATGACGTATCTGTTTCCAGAGTCACTTTCATGTCTCGGGCCACAACAACTTGGGACGCCACGTTCG
GGCTTGATCGTGTGAAGACGAAGAACTCGTTCCAACTCCGACTGGGCTCGCTAGGACTATCTGCGTCAGAACGGTTTGCC
GATATGACGGGATCCCAAGCTGCATTCACGGCAGAGCTTTCAGACGTGCTGATTTCTCTAGGCAACAGAGATCTTACTTA
TCTCGACGCAGATGTCGGTGCTATAGAAGCGCAACTGAGCTCGGAGAGAATCGGATATATCGCATCTCTGGTCGACCGGA
CCGGCGCTCTCACTGCTACCATTGCAGAATACTTTTCAGGCCCCCTCTCTTACGGTGATCGAGTCCGTCCCCTCCTGGCA
CGGCGATTGATTGCCGCTGGCAAGGGGGTTCCCGACCCGAGCTTTCTCGTTCGACCCTCTGCAGTTCTTCGCTCGGCCAA
CGAACACTTGCGAACTTTCGACTCGTGGAAGTTAGCGGTGCGGCTCCGGCAGATCTGGTCTTTAATGAAACATACCGACA
AGGTTCAGTTGATCCGCGACTGTATCGGCTGCGAAGAATCTCCGTCGAGTGGAGGACCATGCTCATCAGAATCTGCTCCG
ACCAGCATTCACGATGTTCTCTCTAGCCTTGATCGATGGAGAGGCTGGGATTTGACCGATGTTGGCCGGTCGATTCTGCT
GCGAAAGCTGTTCGGTGACCTCGCAGGAAACCCAAGCAAAGCTGCCAAGACCCAGCCAGTCCCACTGCCTTTCATGGCTG
TCACCAGGTTGCAAAGACTACAGATGATATTGGATCCAGGGCTGAAACAGAACGAAATACAATTCCTAGACCTCACAGTC
AGATTCGAAAACAATGCACCGACGTCGGTTGGGTCAGCTACGGGAATTCCCACTCTTGTGGCTGGCAAGGCAAGCTCTAA
GTCGATCTCCGTACTCAACATCTACTGTGCAGATTCTGCAATCAGACTGAACTGGGAGATCTGCGAGCTTGTCGAAGACA
TCTTGAAGCTTTATAATTTGAGGATGCAAGAGATGGATCAGCTGTTTGCCAGCAAGACCAAAGCCAAATCCAGAGGCAAA
AATGACTTGACGAAGAATCCGGCGTCTGCTCCCGCGTCAAACGAGCAGACATTCCACATTGTGCTTGCCATGGACCGCGC
TGCTATCATTTTGGACACGATCAATCTTAACATCCGTATGTTCAGCGGGGATCTCAAGGCGTCTCTGCTTCTTCGACAGA
ACAGGCTGGGAGCAATGGACACAAACGTCGTCATGAGCGGGGATTCCATCACTTCCCGGATTAAGAGCCATTCGGAGCTG
TTGATGTCTTCCGAATGGCGCGGCCCTAGCATTTTTGTTTCCTATGACACGCCAACAACAAACGGCAAATGCACCCCTGC
TTTCAAAGCTACGGCTAGCAGCCGAGACTTTTTCCTTGATGTGATGCAGGACCCGATCGTCTTGATGGAAATCCTAGATC
TGCTCGTGAGAGACGAGTTTGCGCAGATTTACCGGTTGAAGGCACAGCTCCCAGTGGTAGCAGCAGCAGCAGATGCTCGT
ACCGAGGCATTGGTTTCTGATGCCAAGACAAGCATGACGGACCGCTTCCCGACATTCTATGTAAAGATAGCGCTCTTTTT
GGATCACTACGTGATCAGCTTGCCGCTTCTGCGTTCCCTGACGTACATCATATCTGGTGTTGTGGCCAGAGTGTCTACAA
CGGCCGACTTTGGCAGAGAGTTTATCTTTGATTTCGACGTCAAAGAGAACTCCCATGATATGCAGGTCTCTGTCAATAAT
GCGCCGCGCAGCGTTTCATTGCTTCAAATCCCTCCTACCAACGGGCGCATAACGACACAGATAAGTGACGTGGAGCAGAT
AATCACGGTGTTTTCGTCTTTGGAGCTGGTGCAGCTGGATGCCTCCGCCGTCTACAGTCTGCTTTCGGCTCTGAATCGCC
CAGAGATCTCCAACACGGTCACGGACATGCAGCAGCAACTGAAGATAATTCAAAATCACCTAACAGAGATTCTCAGGACT
GACGAGCAGCCCGTGCAAGTTAACTCTCGCAGGTCATCAGCTAGCAAGACGCATCGCCAGCTTATATACTCTGTGCATTC
AACATTTGCCGGCCTGGAAATCTTTGGAAACAGTCCGCTGAAAACCGATGTAGCACCTCTAGCTCATCTCTCATTCTGTC
TGGACAGTGTGAAGCTGGAAGTGTCCAATCGACTTGAAAACGGCGGTCCGGTCCTGCCGTACCCCGAGCTCTATATCAAC
CTTCGTCGCATCGCATTTGAAATTATGAAGGGGACTGAGGAGTCCATGTCGTCCTGTGGAAGCGTCGTGTTTGCAGCTCT
GATAACCGCAACGTCCAGGCTGATGGATGATGGCACAGAACGGCGGTCCCTTGCTGTGAAGAGCGATGGATTCGATGCCA
GTTTTTCTCCAGAAACCGTTTCGACGGTGGTAGACGTGCTCGGCTACATGGGAGACAAAATCAAAGATCTTGACACGTCG
CGGGAGATTGAATATCTCCGCAAGCTGAGACAATCGAAGCCTCGAATTACAATCAATGCCCAGGAAGAGCCCGAGGAGGG
AGTCGAGCCGGATATCATCGACGCGTTCCTTTCATCAATGGCTTACTCCTTTGAAGTCAAGAACATTCAGGTCAATTGGC
TTTGTGCACTGACTGCTATCGAGAGACCTTTGCCGGCATACTTCAACGGTGCAAAGAAATGCTTGTCACCGTCTGCCGCC
GGAAAGGAGGACCTGGTGCTGCTACTGGGACGTATTGAACTGGGCACTCGGAACAGGAATTCGGCACGGCTGACAATCGA
GAATTTCCAACTACAAATGGTTCCCCCGACACAAGATAAGCGAGCTCGGTCTCCCATCTCAGCGCTTCTTCCCGAGGTTA
TCTTCAGCGTTGCATATTTCTCTACCCATAAAACTCGTCGATTTGCATTCCAAGCCATCGGAAAATCGCTTGACGTACGG
CTTTCTTCCGAGTTCATCGTCCCGGTAACCCATCTGAAGGAATCCATCCAGCTCTCGATCAAGAACGTGAGACAGGCATC
GCACCAGTGGAAGCCAGCAGCATCGCCGAATGGGGCCTCATTTCCCGTGAAGCGGGCCGAAGCCCCAAAGCAGCCAGCCA
CCAGCGGCAAGAGGCTGGAATCGTTTCTGGTTGATATGGATTTCGCCGGTGCTGTGGTTCACATTAGTGGAAAGAAGCAT
GGCAATTATCTGCCTTCGCATTTTGCGCATGCTTCGCCTGAAGATGCCAGTAGGTCTCGAACATCGCGTCGACCTTCTGT
TGCCGGAAAATATGGCCAATTCAATCCAGACGAGTCTGGCGGCAGCACGGTGTTGCGCTCTCCTGGCCTTGTATGGAAGG
CAAGATATCAGGACAACGGCCGGGAAGATCCTTCGCTATACGCCGAAGTCCGTGTTGACGCTTCAAGCAATGTCCTCTAC
CCGTCTGTTGTACCGTTGGCGATGGATATGACTGCGAGCATAAAGGAGGTCGTCAAAAACTCGGACAGTGCAAGATTTCG
ACTAGACGAACAGGAGGAAGTTGACAAGCAAGGTGGGCCTGTGGAGTCCCCTGACGAACCCCCAGTGATCAAAAAAGCGG
AGCAGGAGGAGAGCATTCTGTCGTCAGCGGCCAACCGCAAATCGATGCTTGGGCGTCTGAAGTTGAACCTCGGCCTCCGA
GTTTGCAGACAGCAATTTTCGCTCAGCTGTCAGCCGATTGCACGCGTCGCTGCTACGGCAAGTTTCGACGACTTCTACCT
CACTGCAAACACGGTCCAGTCAGCAGAGCAGGGCACGTTTTTCGCAGTCTCTGGGAATCTCAGCGGCCTCCGCGCTTCAG
TGCAGCATGTCTACTCGCGCGAGTCGACAGGCAGCTTTGAGGTCCAGTCCATGGTTCTCTCTCTCATGAACAGCAGACAC
GTCAGTGGTGTTAAGGGCATGTCAGCATTGTTGAAAGTCAGCCCGATGAAGGTTTCCATAAATGCAAAACAGCTACAGGA
TTTCCTGCTCTTCCGGGAGATCTGGACAACGCGCGACCTCCGCAATGTCCACGTTGCTCCAGATGTGGCCGAGCGGTTGC
CCGAGACCGCCTCCCTGTCTTCCAGCTCCCAACAGCAGACTCATCTGGTGCAGCGCTACCAGCAGGTGGCGGCCACTGCG
GCATTCCCGTGGACAGCAACGCTTGCCATCTCTGCGCTGGAGATCAATGTCGATCTAGGACAGGCTTTGGGCAAATCGGT
CTTTTCCATTTCGAATCTGTGGGTATCCTCAAAGAAGACGTCTGATTGGGAGCAAAACCTCTGTCTAGGCATTGAGAAAG
TCAACGTCGAGAACACAGGAAGAATGAGCGGGTTTGTCTCTCTGGACGACCTAAAGCTGCGGACATCGATCGAATGGCCG
GCCCGAGTACAGGCCCTCAACGAGACACCACTAGTTCAGGCATCTGTGAATATCAGCCAGCTACGGTTGAAGGTGTCCTT
TGATTATCAGGCCTTCCTAGTGGCGGACATTACAAAACTGGAATTCCTCATGTACAATGTGCGCCGGCGCAAAATGGGCA
GAGGAGACCGCCTTGTGGCGATCTTTGACTGCGACTCTGTTCAGGTAGTCGGCACGACAGCATCGGCGGCTCAAGGCGTG
GCACTGTACCAGGCAATCCTGCGGCTGGTCCAAGAACGCAAGGCCAACTTCGAGGCTTCGCTGCGGGAGATCGAAAGGTT
CATTCGAAGACGGTCATCAGCACCACTAGTATCTGCTGCTCTAGCAGAGATGGGAGATGCGAACAAGCTAGCTCCCTCGA
CGTCCGTGGAGCTTGACTCTTCAAAAGAAAGCATCCCACTAGGAATCACGGCTGAGGACCACAGCAGCGACGATATCATG
ACCAAATCGCCCATATCTTTGGACACAGATGTGGTCGTGACACTCAAAACACTGAATTTGGGCGTTTTCCCAAACTCATT
CACTGAACACCAGGTGCTCAAGATGGAGGCGATGAATGCGCAGGCGCGGTTCACAGCAAACATGGAAAACAAGCGGATCC
ACAGCAATCTCGGTCTGACTCTGGGACAGCTACGCATTGGGCTCGCCGGCGTGCGTCATATACATACGACGACAAGGCAG
CCCGACGGACCACCAAAAACAGTCAATGACCTGTCAGTCGAGGATGTGGTGCTGAGTGTGACGGGATCGCGAGGCGGAAC
GATTCTGAAGGTGCCTCGCGTCGAAGCCGGCATGCAGACCTGGCAGAGTCCAAACTCGCGCCAGATCGACTACATCTTCA
AGTCTGCTCTGGAAGGAAAGGTGGAAGTGGGCTGGAACTACTCGCGGATCAGCTACATCCGAGGCATGTGGGCTAACCAC
TCGCGGGCTCTGGAGCAGACATGTGGCCGCGAACTGCCGCTGACGGCCATCAGGCTTACGGGCGTGATGGACAACACTGA
TGCTGGTGTCGGTAAGGGGAAGAAGGGAGGCGAAGCGGAACAGCAGGCCAAGATCACGGCAGAGGTCACGATGCCGCAGT
CCAAGTACGATTACAGAGCGCTGGAGCCAGCAGTCATCGAGACGCCCCAACTGCGCGACATGGGCGAGGCGACACCTCCA
CTTGAATGGATAGGCCTGCATCGCGATCGGCTGCCGAACCTGACGCATCAAATCGTGATAGTGTCATTGTTGGAGCTGGC
CGGCGAGGTGGAGGATGCGTATGCTCGAATTTTGGGGTCGCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62