GenePrediction:GLEAN_6275 Details

Name: GLEAN_6275
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1131122..1124531 (- strand)
Length: 6592
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1131122..1131115 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_144:1130869..1130137 (- strand)
Length: 733
Type: CDS
Source: GLEAN
Position: GCSC_144:1130075..1128300 (- strand)
Length: 1776
Type: CDS
Source: GLEAN
Position: GCSC_144:1127521..1127436 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_144:1127354..1125149 (- strand)
Length: 2206
Type: CDS
Source: GLEAN
Position: GCSC_144:1125049..1124531 (- strand)
Length: 519
>GLEAN_6275 class=GenePrediction position=GCSC_144:1131122..1124531 (- strand)
ATGGTTGCGTAAGTGCCTTCATACTCTCTTTCCTCTTCGTCACGATGCTCCTCACTATTTGATGTCACTGCCTTTGTGAT
TATCGTGACTTTTTCGTCCACCATGAGATCCAAATCTGCCCACATTACCACCCGGACTTAACACCAGTTTGTCCGGGTGC
CAGGATGTGGAAGAGGATAGAGCTGGCTTGGACGCCTGCTGAGGTTGCTTGAGCAATGAGACGGAGCCGCTACTAACGGT
ATCTTCTCTGCAGCTTCACGATCGACGAGATCCGTCATCTCATGGACAAGCCGACCAACGTGCGCAACATGTCCGTCATT
GCGCACGTTGATCACGGCAAGTCTACCCTTACCGACTCCCTGCTGGCCAAGGCCGGTATCATCTCCACCGCACGTGCTGG
AGACGCTCGTGCCACAGACACACGGGCCGACGAGCAGGAGCGTGGTATCACGATCAAATCCACTGCCATTTCCCTGTTCG
GCACTCTGGACGACGAGGACGACATCAAGGACATTGTCGGCCAGAAGACTGACGGCAAGGACTTCCTGATCAACCTCATC
GACTCGCCCGGTCACGTTGATTTCTCATCTGAGGTCACGGCCGCTCTCCGTGTCACTGATGGTGCCCTCGTCGTCGTCGA
CACCGTTGAGGGTGTGTGCGTGCAGACCGAGACTGTGCTGCGTCAGGCTCTTGGTGAGCGTATCAAGCCTGTTGTCATCA
TCAACAAGGTCGACCGCGCCCTCTTGGAGCTGCAGGTGTCCAAGGAGGATCTGTACCAGTCCTTCTCGCGTACCATTGAG
TCCGTCAACGTCATCATCTCGACCTATCTGGACGAGGCTCTCGGTGACGTCCAGGTCTACCCTTACAAGGGTACCGTTGC
CTTCGGCTCTGGTCTGCACGGCTGGGCTTTCACCATCCGCCAGTTCGCCACCCGCTACGCCAAGAAGTTCGGTGTTGACC
GCAACAAGATGATGGAGCGTCTTTGGGTAGGCAGCGTCCCATCCCTGACAGACAATTTTTGTCCCAGGTGCTGACCATCT
ACTATAGGGCGACAACTACTTCAACCCGGCCACTAAGAAGTGGACGAAGAACGGCGACTACCAGGGCAAGCAGCTGGAGC
GTGCCTTCAACCAGTTTATCCTGGACCCCATCTTCAAGATCTTCGCTGCCGTCATGAACTTCAAGAAGGACGACGTTGCC
AGCTTGCTGGACAAGCTCCAGCTGAAGCTGTCCACGGATGACAAGTCCAAGGAGGGCAAGCAGCTGCTGAAGATCGTCAT
GCGCACTTTCCTGCCCGCTGCTGACTGCCTGCTGGAGATGATGATCCTCCACCTGCCGTCCCCCGTCACAGCTCAGCGCT
ACCGCGTGGAGACCCTGTACGAGGGCCCGCAAGACGACGAGTCCGCCATCGGTATCCGCGACTGCGACCCCAAGGGTCCG
CTGATGCTGTACGTGTCGAAGATGGTGCCCACCTCTGACAAGGGCCGCTTCTACGCCTTCGGCCGTGTCTTCTCTGGTAC
CGTCAAGTCTGGTCTGCGCGTGCGCATCCAGGGCCCCAACTACGTCCCGGGCAAGAAGGAGGACCTCACCATCAAGGCTA
TCCAGCGCACAGTCCTGATGATGGGCGGCCGCGTCGAGCCCATCGACGACATGCCTGCCGGTAACATTGTCGGCCTGGTC
GGCATTGACCAGTTCCTGCTGAAGTCTGGTACCCTCACCACCAGCGAGACGGCCCACAACATGAAGATCATGAAGTTCTC
TGTCTCGCCTGTCGTGCAGCGCTCCGTCCAGGTCAAGAACGCCCAGGACTTGCCCAAGCTCGTCGAGGGTCTGAAGCGTC
TTTCCAAGTCTGACCCTTGCGTCCTGACCATGACCACCGAGTCTGGCGAGCACGTCGTTGCCGGCGCCGGTGAGCTGCAC
TTGGAGATCTGCCTGAAGGACCTCGAGGAGGACCACGCCGGTGTTCCCCTGATCATCTCCGACCCTGTTGTGCAGTACCG
CGAGACTGTCACGGCCAAGTCGAGCATGACTGCTCTGTCCAAGTCGCCCAACAAGCACAACCGTCTGTACATGGTTGCTG
AGCCCATGGACGAGGAGCTGGCTGGCCAGATCGAGTCCGGCAAGATTGGTCCCCGTGACGACTTCAAGGCCCGTGGCCGT
GTCCTGGCTGACGAGTTTGGCTGGGATGTCACCGATGCCCGCAAGATCTGGGCGTTTGGTCCCGACACCACCGGTGCCAA
CCTGCTGGTTGACCAGACCAAGGCTGTGCAGTACCTGAACGAAATCAAGGACTCTGTCGTGTCCGGTTTCCAGTGGGCAA
CCCGCGAGGGTCCGGTTGCCGAGGAGCCGATGCGCTCTATTCGCTTCAACATCCTCGATGTCACCCTGCACGCTGATGCC
ATTCACCGTGGTGGCGGCCAGATCATCTCGACCGCTCGTCGTGTGCTGTTCGCCTCGGCCCTTCTGGCTGAGCCGGCTCT
CCAGGAGCCTGTCTTCCTGGTTGAGATCCAGGTGCCTGAGCAGGCCATGGGTGGTGTCTACGGTGTCCTGACTCGCCGCA
GAGGTCACGTCTTCAACGAGGAGCAGCGCCCGGGTACCCCCCTGTTCACCATCAAGGCGTACCTCCCCGTCATGGAGTCG
TTCGGCTTCAACGGCGACCTGCGCGCTGCTACCTCTGGCCAGGCTTTCCCTACGATGGTCTTCGACCACTGGCAGATTCT
GCCCGGTGGCTCGCCGCTCGACTCCTCCTCCAAGGTCGGCCAGATCGTCCAGGAGATGCGGAAGCGCAAGAGCATTAAGG
TTGAGGTTCCGGGCTACGAGAACGTAAGTCAAGCTGAAAACATTAGACAGACCAAAGAGAGGACGATGATTGCTAACTCT
GTCAACAGTACTACGACAAGCTATAAACGCCATCACCCTTTTCTTCCTCTCCCCGAGCTAATTCGCGGTTTCCTCTGCCG
CTCGGTGGCATATCCCTCACGGAAGAACTGCTGCTGCGGACGAGCGTCTTTAGTTTAAGAGGCGGGCATCGATCATTGCA
GAGGTTTTTTTCGAGGCGACCAAAATGGGTCGATAAAAGAAAAGAAGGTGCTGGTGGTCAGACAATGAGCAGGAAAAGCG
GGTGCTTTTCTCTGCATGTTAGTAGTTTGTACTGGTTTAACGCATTATTTCCCTTAGCTGCTACGGCAACATGTATGGTT
CTTTTTTTGATGCCTTTCCGTCGTAACATGAATAAAGATTGGGGCAAGCTGAGTTGTCTTATGAGCACGAGGCGTCTAAA
GCATTGTTCCACGTGCATTGCCTGCAATGTTACTCGTTAGAATAAAAGTTACAAACCGTATCGGAAATACAGCTCAGGTA
TCACGTGGAGATAAGATTTATGTAGCATAAGTGGGGCATTCGGGTGCCTACAGGAAGCTCTCGAAAAAGTTACTTGGAAG
TAATTGTAAGCTGTGATATACGAGTAGTCAATTCTGGATCGCCTATTTGCTATTCGCCAACAACCCAGCCACTGCAATTA
CCTGGTCCGGATATCAGACAATAGGCGTATTCGATTATTTATTTGCTCTTGAATGGTATTGTTAGATTAGGCGCTGTCCA
GGCGGTCGCCGCAGCGGGCACGATGTTGTTCCCCGAGCAAGACGCGCCGACACTGAAAACGTGGATCGTGAAGCGCCTCG
AGACGCCGTGAGTTACGGAGGCTCCATGTGGAGGTGGACGCTTGCCAACCCCCTGAGCCGTTCTCTAACAAGCGGGTGTG
ATACACAGAGCACGCACGGACAGTGACGTCGATGCGGATGTGCTCGCGGATTACGTTCTTGCGCTGCTCCGACACGATGG
TGAAGCGAACGATGTGCGCCAACTCTGCGAGACGGAGCTGTATGACTTTCTCAAGGATGGTATGAACAGCCACACCTCTC
TCTTGTCACATGGACAGCATCCCTTTCTACGAGTGGACACCCAGCTGACGGACCTCGTGCGAATAGAAGCAAAGCCCTTT
GTCGACGACGTCTTCCAGACTGTGACCTACAAGTCCTACATACCAGGCTCACGACCGCCTCCGAAGCTACCGCCGCCGCC
GCCACCAGCAGCAGCACCCACACAGATAGCATCAAAAGGATCTGCCTCGCTGCAAGGGGCAATTGATGGACCGGTCCCGG
GACTCCCTTGGTCATATCAACAGCAGCAGTTTCAGTACCAGCCCAGCAACTCACGAAAACGTTCCTACAACGAGTCTTCG
ATTCCAGAGATGGGCGCTGCATCAGTGCCACCGGGTATGCCATACTACCAGCAAGGCGGTGGACGGGCGTTCAAGCAGGC
ACGTCGTGGTGGCGGCACCCGAGGAGGACGAGGAGGCGGCTATGGCGGCGCTGGGGAGACGATGGGCCATGTTCCTGATG
CTGACCTGGCGATGGGGCCTATGATGCTGCCGCCACCACCATTCGGCGCGCTTGGCCCAGGCACAACGAACAGCCCCACA
CCTGGATCCATGTCCCTGGTGCCGCCCAACGGCGCGTCCCCTTACGACCCATCTGCGGGGCTCTCTATGGAGGCTTTGAT
GCAGATGCACCAGATGGGGATGCCCGTTCCAATGTACGGCTTCCCGCAGGGCGTTGTGGGTCCTTGGAACGGCAACGGCA
ACGGCAACGGCAACGGCGATGATGGTGGCAGACGCCGGCGACGTCGCTGTCGCTATTACGAGAAGAAAGGCTTCTGCACA
CGGCCCAACTGCCTGTTCGACCACGGCGAAGCCCAAGAGAGCGAGGACGCGGCGGCAGACGGGCACGGCGGGGTGTTTTC
CATGATGCCACCACCAGCGGTAGCGGCAGCCATGTTCCAGCATATGATGCCTCTACCACCACAGCAGAGGGACGAAGCAC
CGACAGAGATGCCAGGAGCACAAGGGGCGACAAGGCGGGCACGGAAGGGCGGGCGGGCGCCGTTCTCTGCAGACGGGCCG
GTGTACGACAAGAGCAACTCGACAGTGGTAGTGGAGGGCATCCCGGACGAGAATCTCAACGAGGCAGCAGTGCAGGAGTT
TTTCTCACAGTTTGGTCCCATTGTGAGCGTCTCGATGCAGGCGAAGCGGAAGCTGGCAGTGGTAAAGTTTGACGAGTGGG
CGGCGGCCAACGCGGCGTACCACTCGCCTAAGGTGATCTTTGACAACCGTTTTGTCAAGGTGTTCTGGCACAAGGAGCGA
GGGAGTGGAGGAGGCGGTGCGGGAGACGAGACAAGCGGCTCGGGCGCCAAGAAAAACGGCAGCAGTGCTGCAGGGGTGGA
GGAAGGCGAAGTGGTGGAGGGAGAGGACGGCGAGATGCCAGAGATGGACATGGAGGACTTCTTGCGGCGACAAGAAGAGG
CGCAGAAGCGTCACGAGGAGAGGGAGCAGTTGAAGCAGGAACTCGAGCGCAAGCGGCAAGAGCTGGAGCAGCGGCAACGA
TCACTACAAGCGCGGCAGCGGGAAGAGAGACAGCGGCTGATTGCCAAGATGGCAGCGGTGGCGACGCGGGCGCGACAGGG
GAGCGAGTCGGGCACGCCATCGGAGTCGGGAGGCGGAGGTGGAGGCGGAGGTGACGGTGACAGCGGGAGCAGAGCGGCGT
CGTCATCGTCGCGGTCAGCCGCGGCGATCTCACAGACAGAGATGATCCGGGCTCAGCTGGCAGCGCTTGAGGAAGAGGCC
AGACAGCTGGGACTGGACCCAGATTTGATCGTTGGTGGTGACGCTCTCTCAGCACCGCTGCCATCGTGGCGAGGCCGCGG
ACGCGGACGTGGTGGACGGTACAGTTCCTATACGCCTCGGGGCCGAGGCCGCGGTGGTTATGCAGCACGCGGTGGGCTTC
ATGGCAGCGTCAGCAGCAGCGTGGCCTTGGCTTATGCGGCATACTCGCTCGACAACCGACCGCGGCGGATCGCTCTGACG
GGGGCCGACTTTACGGCGCCTGGGCATGACGAGGCGCTGCGGCAGTATTTATTGGTAAGTTTTTCTGTTCTTTTTGTCTT
GTCTTGTATTTATATATCTTTTCCTTCTTCCTTTTTCTTTTATTTTATTTTAACTGCTTACTAACTTCGTCAGGGCGTTG
GTGACTACGTGGCCCTTGACACGACAGCAGAGACGACTACCATTTCGTTCACGGACCGACGGACGGCAGAAAAGTTTTAC
TATGGCCTAGCCTTGGCCACAGATCAATCGGACAAGCCGACACGAAGGATTGTCCCGGGCGTGGCGGATCCGGTGGAGCT
GGCCTGGGTGGCGTGCAGCGCCGTCGGGAGCAATGGTGCAGGGACGACATCTGGCGGATTATCTGGGCCGTTGACATCTA
ACAATACGCTGTCTGGTAATGGCGCGGCCGAAAAGAACGGGTCGTGGCAGCCGGACGAGGAAGGCGAGCTGGATGCGGCA
ATAGATGGCGGAACGGCCAACGGCGATGAGGACAATGCAGACGAGAACCTGGACGAGGACGTGGATGGGATAGACCAGCA
GCAGGACCAGGAACAAGAGCAGGAGCAGAAGCACAGCCGCCACGGCTTTCCGCAGAAGCAGCAGCAGATGGACTTTGACG
TGGCAGACGAAGGAGACTGGGACATACAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62