GenePrediction:GLEAN_6276 Details

Name: GLEAN_6276
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1120072..1116184 (- strand)
Length: 3889
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1120072..1117231 (- strand)
Length: 2842
Type: CDS
Source: GLEAN
Position: GCSC_144:1117122..1117011 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_144:1116943..1116184 (- strand)
Length: 760
>GLEAN_6276 class=GenePrediction position=GCSC_144:1120072..1116184 (- strand)
ATGCCCGTCATTCCCGAGGAACATGTCTCGCCCAACATGGACGACTTTGTCAATTGGGACAATGCGGGCTCGCCTGCTGA
TGCCATGATGGCCGATGATGGTGGCTCTGCTACTTTTTGTGCTGGCATCCCCCCAGAGTTGGTCGCTGTCGCTGTCGCGT
CTCAGCCGTCTGACGACAGGGCTGCCCTGATGTTCGAAAACCCCGACGCTGACGACTTTTCCTTCTGGGCCTTGGAGCAC
TACGACCAGAGCAATTCCCCAGGCGCAGCTAAGCCGGTCGGCCTTCTCGATGACGGCATCGCCGCTGCCGACTGTGCTCA
CGCCGATGGCGGCGCATCTGCCATTCCGGAAGAAGCACACGACTTCTGCCCTATCGAGGTCTGGGACGTCCCCGGCGAGC
CATGCACCCACTGCAAAACGGGCGGCTACCAGTGCAAGACGATCCAGGAGGGTAGCTACAAGGGCTACTGCACCAGCTGT
GTTGCCCTCCGCTGCGAATGCAGCTTTGGTCTGGCCTCGGGCGGCCCTCTACCCACTTCCATCTCTTTCCCTCCCAACCC
GTGGCCGACCCTCGGCGATCATCCTGACCCCATCCCCCATGACCATGTATCTCTTGCCGTCCACAGCTCGTCTGCACCGG
ACAACGCTGGCTGGGCCGGCCAGACTGGCTCGCAGCCCAGCGATACGGCCGCACAGCCCAAGTTGGGTGCCCGCTTCTCG
AGAGATTCCGTGAAAATTCTGAAGAACTGGGTGTCCACGCACAGCCGCCACCCCTATCCGACCGAGGAGGAAAAGGAATC
GCTCCAGCACCTTACCGGACTCAACAAGACTCAGATCTCGAACTGGCTGGCAAATGCTCGGCGGCGGGGAAAGATCCCGA
CCACCCGATCAACCTCGCCGCACGTCAGAAACAGTTGGTCTGGCACCGGCGCTGTTGATATTCCCCAAAACCGCCGGAGC
GGAACACCCTCTCCGTTTGACCGGAAGCTACAGCAGCTGGACAACATCCTGCTGCAGCGATGGGCTAATTCCCCCCCCGA
AAACGAGCCTGCCTCTGTGACGGATATTGCTCGAGCCATCACCTCATCATCCTCGGCCGTGTCCTCCGGCCTGAACAGCC
CTTACAGCTACAACTTCACCGATGACGGTTCTGGTCGCTCGCTCTTCAATGGCTCCTCGGCCAGCAGCGCCGGCACATCG
CATTCCAGTGGTGGCGGCTCCTTTGCGTCTGCCTTCTCTCACGGGTCGCGCGGGTCTCTGAATTCCTTTGGCTCGCTCGG
CCGTGGCCGTCGGCGTCGTCGTCGGCGGTCGGCACCTCTTTCTGGACTCGGGTTCGGAGGTGGAAGTGGTGAAGAAAGGG
AGCCCGGGAGCGCATCTTCTGGTAAGGGATTGGGCGGCGACAAAGGCAGAACGAGACCGACGACACTCCAGCCACTCCTT
AAGACTTACCAGTGCACTTTCTGCACGGAAACGTTTAAGACCAAGCACGATTGGCAGAGACACGAGAAGTCATTGCATCT
TTCCTTGGAAAGATGGGTCTGCGCACCACAGGGAGCAGTGGCCGTGCATCCAGACACAAAGCTGCCGAGCTGCGTGTTCT
GCGGAGAAGCCAGTCCAAATGAAGGACATGTCGAGTCCCATAACTTTACCGCCTGCCAGGAGCGCTCCATGGGCGATCGG
ACCTTTTACCGGAAGGACCACCTTCGCCAGCATCTTAAGCTGGTTCACGGAGTGAACTTTGTCGGCTGGGCAATGGACCC
CTGGAAGATAGCCACGCCCGAGATCCGCTCTCGATGCGGTTTCTGTGGCATAGTCATGGACACATGGTCCTTCCGAGTAG
ACCATCTGGCTGATCACTTCAAGACTGGTCGTACTATGGCTGACTGGAAGGGCGATTGGGGTTTCGAAGACCCGGTACTG
CAGATGGTGGAAAACTCCATTCCGCCGTATCTCATTCACAATGAACGCAATACGCCCCTGCCTTTCACGGCCAATGCGAT
ACCGCCACACAGCCCTCGGAATTCGTATGAACTACTGACGGGCGAGCTATCCTACTGGCTGCAGATGCGAGCCGAGGAAG
GTAAAACACCAACGGAGACCGAGATGCTGGTTGAGGCATGTCGGGTGATCTTCGGAGCCGACATGCTGGCTAGGAACAGT
AACAACATCAATAGTCCGTCGTGGCTCCGTGACCTTCTGATGTCAAATGAGGATTGCAAACAACATGCCCGCCTCAGCCC
CATCCGATCAGCACTCGACAGTCAGATGGCCACAATACGCATTAACGGAAAGGGGAATATATTTGACTCCTGCCCGCTGG
AAGCAGGCTTGCAGGATTTTGTGGTACGTCGGGCTCAGCTGGGCTTGACGCCAATGAACGCAGAGCTGAGGGCAGAAGCA
ACACGGATCGTAGGTGAACTGGAGGCCCAGTTGGTGGACGAGGCCGGCAAGTCAGCAGATGCGGGCTTCCGTCGTGCACC
CTTTGACAAATGTGTGGTAGATTTTATTCTCCGACTAGTCGAGAAAACCACAAGCTGGCTCACTGCGTTCCGACAGCGAG
CTCACCTACCCCGGGCCGAGGCCATTGCAGACGAAACTCGACGGCCGGTCGACGATCCCAAGAGCATCGATGCCGCTGTT
CATAACGAGGCTCGCCTGGAGGCAGAGCTAAGCGATTTTGTGCGTCAGCAGATGGAAGCTGGCAAGCCAGCTCCAGATGA
CGCCGCTCTACAGCGTCAAGCACGACTTATCATCTACGAGCTTGACGATGGGTGGAACCAGACTGCAGCTGATGGCCCTG
AGTGGCTCACATCCTTCAAGTCGAAGCATATCCCACAGTTAGGTATGCGAGGTCCAGGTACTTCAATCAGCCCGTCAAGC
GAGAACGGTCTCGGATTCCTCAAGCCTTCGCCATTTTTTCTAAACGACACAAACTGCTACCGCCGACTAGCCAGAGAACT
CACCCGCTATGTCACGGCGGCCATGTCACCAAACAACCCCAATTGTCATGTGCCCACCGATGAGGAGCTGCAGCACCAGG
CGCGGTGGATCTTATATGACGAGTGAGGCATTTTCCGCTATTAATCGCCTTTTGTTTGTTCTGGGGTTCCTCTTTACTGA
CCTGTCCAGCGATGACCCTTGGAACCAAACGGCAGCCGACAACGCAGAATGGCTGATGCGATTCAAGCGCGACTCCGGCA
TTTTGCCAACCTCCAGTGGTCCGGGCCTCATGGTCGAGAGCCAAGCCTGGAATGTCAAGCAGGGCGGCACGGGCTTTGCG
CCACCATACTGCTTCCCCAACATGCCGATGGCGCCCTTCAAAACGCCGCCCGGTGCAGAGAACAGCTCCGGCGACAGTGA
CCACAAGATGATCGTCTTGCAGCTACAGGATGGAGATGTTCATCGTGGTGTGCAGTACGAGCTGGCGTCTTCCGCAGCCA
ACAAGTTCTTGCAGTCGTTCAAGACGCGCTATGCCAAGCCAGCTACTGTGTTCTGCTCGCGTGAGCTGGAAAACGGCCTG
ACGTACTTTGTGCATACAGCTGTGCACAACGGCGATACCTTCCCGGATGACATGGCCCTGAGGAACAAAGCTCGCGAGAT
CCTGGGCTGCAGCTCGAGCAGTGGGATTACACCTGCAGACGACGGCGTACTATTGGCAAAGTTCAAGGAAATGATGCGCA
CGAATCTGTCAGAAGAGAGGCAGGAAGCCTCCACGTCCGAAACTGCGATACCTGTGGACACGAACATAGAAACGAACTTG
GACTTTAGTTTTGACGACACCGCCATGGATCTCAACTTGTCTTCAGTGACACAGACGGACATTGATACCATGCTGCAGGA
CATGAATTTTGACTTTGAGATGGGAACAGAATATACGAGTGCGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62