GenePrediction:GLEAN_6277 Details

Name: GLEAN_6277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1115630..1114581 (- strand)
Length: 1050
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1115630..1115552 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_144:1115450..1115410 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_144:1115350..1115090 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_144:1115031..1114972 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_144:1114838..1114581 (- strand)
Length: 258
>GLEAN_6277 class=GenePrediction position=GCSC_144:1115630..1114581 (- strand)
ATGCGTCTCACCGCAGACCTGATCAACGCGTCATTGTCATACCTGAACCCGCTCAAGGAGCGCGAGCTCGACCTGCGAGG
TGGGTTGTCGGGTTGTTGGGGGGAAGGGGAGAAGAAATACAGGAGAGACAGTGCAGAGCCATGTTCGATTGGAAATGTTG
ACCCAGAGCTTGATGTATAGGACACCGGATTCCGCAAATCGAGAATCTGGGTGTAGCAGGGGTAAGCTTCTCCTTTCCCG
TGCCGGCATTTAGTCCATTCTGACCGTCTTGCCTTGACAGCCCCAAGATGCAATCGATCTCACGGACAATGACATCCAGG
TGCTCGGCAACTTCCCTCTGACGCCGCGGCTGCGCTCGCTGCTGCTGGCCCACAACCGGATCGCGGCCATCCAGCCGGGC
CTGGCGGACGCGCTGCCCAATCTGACGAACCTGACGTTGGCGTCGAACCAGCTGTCCGAGCTGGGCGACCTGGATCCGCT
GGCCCGGCTCGGCCGGCTGACGCACCTGGTGCTGTTGGAGAACCCGGTGACCAAGCGAGAGGTGAGATCTGGGCCGTCTT
GGTAACTTACTGCACAGGCACGGACTGACCGGATGACAGCACTACCGGTACTGGGTCGTCTGGCGGTGTCCGACCGTGCG
CTTCCTCGACTTCCAAAAGGTCAAGGACGCCGAGCGGCGCAAGGCCGAGGAGTTTTTCGGGACACACGCATTGCCGACCG
AGCTGGCAAAGAAGGCAAGCATTTCCGCGGATCTTCGTACACGACAGATTCTGTCTCTAACGAGCCATGCAGATCATGAG
CACCAAGTCGAGAAAGTTTGATGTGGTGACGGGTGTCGGTGGACGCCGGGCTGCCGGCGGTGCTGCCGGCGGTTCCGACG
GCACGTCCAGGCTGTCACGCATCAAGCTGACGGACGCCGAGCGCAAGCGTCTGCAGGAGCGGATCAAGAAGGCCAGCAGC
CTGGAGGAGATTGCCCGGCTGGAAAAGGAGCTGTCCGAGGGCCGGCTGCCGACGGGCATCTACGCAGAGGGCGATTCCAT
GGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62