GenePrediction:GLEAN_6278 Details

Name: GLEAN_6278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1107999..1103271 (- strand)
Length: 4729
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1107999..1107705 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_144:1107641..1107538 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_144:1107471..1105183 (- strand)
Length: 2289
Type: CDS
Source: GLEAN
Position: GCSC_144:1105115..1103271 (- strand)
Length: 1845
>GLEAN_6278 class=GenePrediction position=GCSC_144:1107999..1103271 (- strand)
ATGTCGAAAGTGGCTGGCCGACGGAGCAAGTTCGAGGAGCTTCGGGCCCTGCGGAAAGCGGGCAAGAAGGCCTTCGACTC
GTACGAAGTGGAGGATGCCGACAAGCTGTACGAGTTGGTCGACGATGATCAGTACAAGAACATTGTCCGCTCGCGCCTAA
ACCAGGATGACTTCGTCGTTGACGACAATGGAGAGGGCTATGCGGACGATGGCCGAGAGGAATGGGATCGTGCACATGTG
TACGAGTCCGACAGTGACGACAACATGGTTGCCCGGACAAAGGACCGCAAGTCATGTAAGCTGTCTTTTCTTCAATCCTG
TCTCCCCATGCATCGCACATCTGCTAACCTGACTGCAGCCAAGAAGTCTCGCGAAGAGGACCAGGCAAAGAGGGATGCCA
ACGATCGGAACATCGCCGAATACTTCACAAAGGGCGCTGCAAAACCACAGGCAAAGACAAAAGTACGTATAGGCCTGAAG
CCCCTTCGTTCTTGCTCCTTCTCGGGCTATCAAAGCTAACCGTGACAGGTTGTAGTTACAAAAGACGATGACAGCTTCAT
GGCCAGCTTACTAGATGAGGTCGACACCAATCTCCCCACTGCTCTGCCAGTCATAAAGAAGAAGAAGCGGACGGTGGACC
AGCGCAAATCCCGAGACTTTTCCCCCCCTGCGGGCATCCGACAGCCTCTCCCCAAAAGAGCGAAAGTTGAGCTACCACCA
GCGCCGGCTAACATCAGCTTCGCGGACGACGACGACGACGACGATTTTGCCGCCCTCCATGACGAAAACATTCCCGCCAG
TGACGACATCCCGATGAGTGATCCGATGCCTTCATCGCCTACCGTCCAAGTTGCCAGGCGCAAGGCTCAGCCTGCCCAGG
CTGTTGCGGAGCAGATCACGACTATCAAAGAGGAGGAAGACGAAGACGATGGCATGATGGAGGTGGCCCACGCCGGTGCT
GTGACTGCCGCGAGCGTGAACTTGTCTGCGGCACGGCCATTGAAAAAGCTGGTCAAGGAGGAATTGTTCCTATCGCCGAC
CAAGGCTGCTGTCGCCGAGGACAAGGTCGACGCGTCGGCCTGGAACAAGCTGAACGATAAGCTCAACGTGATGAGCAGTC
CAAAGACAGCAGAAGCAGAATCACACACGATGGGAGGCAAGGTCGACTACAAGGACGCCATCGAACAGGACGGCAGCCTC
AACTTTTATTGGACAGACTACACCGAGATCCATGGAAGCCTGTGTCTGTTTGGAAAGGTTCTCAACAAAAAAACCAAGAA
GCACGTCAGCAGCTTTCTCAAGATCGACAACATCCAGCGGAAGCTCTTTTTCCTACCGCGCCAACGGCGCAGCCAAGACG
GCGAGGAGACTGGGGATGAGGTCAGCATGGCGGATGTGTACGGTGAAGTGGACGCTCTCATGACGAAGATGGGCGTACCG
CAGCATAAGACGAAGCCTTGTACACGAAAGTATGCGTTTGAGTTACCGAACATTCCCAAGGAGGGCCGGTACTTGAAGCT
ACTGTACCCGTACACAAAACCAGTGATTGCCGAAGCAGGCGGCGTGACGTATTCGCATGTCTTTGGCACGAACACTGCGC
TTTTCGAGCAGTTTGTGTTGTGGAAGAACGTGATGGGCCCTTGCTGGCTCAAGATCGAGGATGCAAATTACAGCGCGCTG
AAAAATGCGTCACACTGCAAGCTGGAGGTGCTCGTCGAGCACCCCAACATGGTGTCGACGCTCAATGATGCCGACGCTCC
AGAAGTACCGCCGCTGACGATGATGAGCATGGCGGTGCGGACGGTGTACGATGATAAAGCAAAGCGACAAGAGGTGATGG
CGATCAGCGCGCGGATATACGAAAACATTTCTTTGAGCGACACGACACCGGCTGAGAAGCTGCCATGTCGGACATTCACT
GTGATCCGGCCGAGCAGCGACGGCTTCCCTCTGGGCTTCGAAACCTTGGCGCACGACAAGACACGGCATCGCGGTCTGGT
GCGGCCAGTGAGACAGGAGGCTGAGGTTCTTTCGTTCTTCCTGGCACAGGTCTCGAGCGTCGATCCAGATGTGATTATGG
GTCACAAGCTGGAGGGCGCCGACTACAGTGTTCTCCTGAGTCGGATGCGTACTCTCAAGACGCCAAATTGGTCGCGACTG
GGGCGGTTCCGGCTCAACCAGTGGCCCGGATCGCTGGGACGAGGCGGCAGCGACGTATTTGCGGAGCGACAGGTGATCGC
GGGCCGGCTGCTGTGTGACCTCGCAAACGATGCCGGGCGATCGGTCATGTTCAAGTGCCAGTCATGGACGCTGACGGAGA
TGTGCAGCCTGTATCTGGGCGGCGACAACCAGCGCCGTGAGCTAGACAACGAGGTGGCGCTGAAGACGTGGGCGAAGACG
AAGGAGGGCCTGCTGGACTATGTGGGCCACCTGGAGGCGGACACGTACTTCATCGCAGCGCTGGGGCTGCGAGTTCAGAT
CCTGCCGCTCACAAAGGTGTTGACGAACCTGGCAGGTAACTCGTGGGCGCGCACGCTGACGGGAACGCGGGCAGAGCGCA
ACGAGTACATTTTGCTGCACGAGTTCCACCGCAACAAGTACATCTGCCCGGACAAGCAGAAGTTCCGGGGGCGCGGACAG
GGTGAGGACGACAACGCGGACGGCAAGAAGAAGGACAAGTACAAGGGTGGTCTCGTGTTTGAGCCAGAACGAGGCCTATA
CGACAAGTTTGTGCTGGTCATGGACTTTAACTCGCTGTATCCGTCCATCATCCAGGAGTTCAACATCTGTTTTACGACAG
TCGAGCGGGCCGCTCTGGTGGGTATTTTTTTCGTGGCTCTTTTCTCCCATATCTCATCGCACCTGCTGACATTTGGACTT
GCAGTCGGACGAAGGGGACGCTGTTCCAGAAGTGCCGACGGAACAATCACAGGGCGTGTTGCCGAGACTCATTGCGACAC
TGGTGTCCCGACGTCGACAAGTGAAGAGTCTCATGAAGGACAAGACGGCGACGGCCGAGGAGCTCGCGACATGGGACATC
AAGCAGCTAGCACTCAAGCTGACGGCCAACTCGATGTACGGCTGTCTGGGATACACACAGTCGCGGTTCTATGCACGGCC
GCTGGCAGTGTTGGTGACGTACAAAGGCCGTGAGATTCTGCGGAGCACCAAGGAGCTGGCGGAGAGCATGTCGCTGCAGG
TGATTTACGGCGACACGGACTCGGTCATGATCAACGCGAACGTGGACAACGTTGCGGACGCAATGCGGGTGGGACAGGAA
TTCAAGCGGACAGTCAACGAGCGATACCGGCTGCTGGGAGGATTTGACATTGACAATGTCTTCCGGCGGATTCTGCTGCA
GGCGAAGAAAAAGTACGCGGCCATCAATATGGTGGAGGTGGGCGGCAAGTACGTGGAGAAGATGGAAGTAAAAGGACTGG
ATATGAAGCGGCGCGAATACTGCGCGCTGTCCAAGGAGATGTCGACGCGGATCCTGAACGAGATCCTGTCGGGAGAGGAG
ACGGAGGTGTCGGTGACGCGGATCCACGCGTATCTGCGGGAGATGGCAGCGAAGATGCGGGGAACCAGCAGCGACGAGAC
GGAGGACAACAACGGCACGACGACGACGACGACGACAGCCAGCAGCATCCCAGCGGCCAAGTACATCATTTTTACGCAGC
TGGGCAAAGAACCGACCGACTACCCGAACGCGGAAACGATGCCACAGGTGCAGGTTGCACTGCGTGAACGATCTCAGGGC
CGAAAGGTCAGCAAAGGCGACGTGGTCAGCTACCTGATCGCGACGGGCACATCGGCACCTACATCGGAGCCGGCAGCCAA
GCGGGCGTATACGCTGGCGGACGTGCAGCGCAAAGACTCGGGCCTGACGCCGGACGTGGAGTGGTACATTGGCAAGCAGA
TCTTCCCGCCGGTCGAGCGGCTGTGCGCCAACATTGTGGGAACATCGACAGCACAGCTGGCTGAGAACTTGGGGCTGGAT
ATGCGGCGATATGCGGCTGGTGGCGGCGGACAGGGACAGCACGGTAGCAATGGCGGCATGGGGGTCAACGGTGAGCTGAT
GGAGGTGCACCCGCTGGAGTCGCAGATCCCGGACGCAGTGCGGTTTCGCGACTGTGCGCGGCTACAGCTGCGATGTCGCA
AGTGCAAGGCCACGGACCAGTTTGAGGGCCTGTGGAGTGAAGACGGCGAACAGACGATCCAGGCTGAAAAGGCGATGCAC
GTGACTCCGGCAGGTGTGGCTTGCAAGTGTGGCGCAGCGCTGTCGACGCTATCGGTAGTGGCGCAGGTCGAGCACGCAGT
GCGCATGGCGACGTCACGCTACTACGAGGGCTGGCTGGTCTGCGACGACCCGTCATGCGGCCAGCGGACACGGCAGATGA
GCGTGTACGGGACGCGGTGTCTGGGGCCCAAGGGACTGGCTCGCGACTGTCTGGGCCGCATGCGCTACGAGATGGGCGAG
CGCGACATCTACAACCAGCTGGTGTACTATGCCGGCCTGTTTGACGTCGACAAGGCGCGAACAGCCGTCCTGGCAGCAGC
AGCCGACAAAGACGAACAAGATCGCGTGCTGGCGCTGGCCGAGCACAACCGCGTGCGCTTTGGCAACGTCAAGGCGGCCG
TCGAGCGCTATCTCGACAAATGCGGCCGGCGCTGGGTCGCCATGGACACGCTGTTTGCCAAGCTGGGCTTTGCGGTGCCT
GCACGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62