GenePrediction:GLEAN_6279 Details

Name: GLEAN_6279
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1093804..1091641 (- strand)
Length: 2164
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1093804..1093745 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_144:1093308..1092598 (- strand)
Length: 711
Type: CDS
Source: GLEAN
Position: GCSC_144:1092536..1092378 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_144:1092311..1092153 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_144:1092069..1091641 (- strand)
Length: 429
>GLEAN_6279 class=GenePrediction position=GCSC_144:1093804..1091641 (- strand)
ATGGTCGGTGTTCCAGGACGATCAAAGGCTTGCGCGACCTGCCGCCGCCGGAAGAAAGGCGTGAGTTTCCCAATGTGCAA
TTATTCCCATTGTTCTCTATCGTGCCCCCCTGTCTTCCCCCCCCCTTAAAACCTGTATCGACAACTGCTCCGTCGATGTG
GAGAGAAAGGCATGCCCGCTACCAGGGGCAAGCAACCGCGCGTTCCATGCACAGTCGGCAGTCTGCAGCCTTAGTTTATC
GTCGTTGGACATCGGCCGGTTTGCCGGTTCGTCGAAAGGCCGTATAGACAGGACTGGCTTGTCGAGTCAGATTCGCACAC
TCCTCTTTTTCACTTTGTTGCTTTTTCTACCGTCACGTCGTCCACCTCCTAGTCTTTGCCCCTCTCCCACATCCATCTTT
ATCGCTCCGTCTGTCCGCCCCTCATCCCCCTCATCGGCCTTTCCGCTCCTCTTTCGGCCAGCCGAAGCAGCCTAGCTCAC
TGACACAAACATCCAGTGCGATCTCAAGCGGCCGTCATGTACGCAATGCCGGCGAGCCGGCCTCGAGTGTGGCGGATACG
AGCGTGGACGCATCTTTGTACATTCGACGCATAACCATCCCCTTCGCTTCTCGCGCGAGAGAACCTCGACGCCCGGCTGC
AGCAGCAGCAGCGACGGTGTCGACGATGTCCTGGCTGCCTCGATCGCTGCCACCACCGCCGCCATCCAGGCAGACAAAGG
AGCGTACCGCAGAACCAGCACCAGCCCCGGCACCATCTCCAGCTACAGCAGCAGTCCGGTGCGGCGGCCGGCAGACTACC
GCATTGTGCCGGTATGCTTCGGTACCGGCCAGGTCCAGCTGACGGCAGAACCGCGCTCCGACAGCGCTCTGCTCGGCTCG
GCTCGTGAGGAGAACATGCTGGCCACCTTCTGGCAGTCCTACCTGCCCAACAGCACGCGCTTCTCCAGGCAAGCGGCCGG
CTATGCCAGTGGCGGCTGGACCAACGTCGTCCAAGCACTCTACCGCAAGGACCACGTCCTACACTACAGTCTCATGGCCA
ACTGCTTTTCTGCCATGTCCCGCATCACCGGCTCCCGCGCCATGGCCGAGCAGAGTCTCCGCGCCCACGGTCGTGCCCTT
CACCAGCTGCGCCTCGCCCTCAACCAGCCGCAAAAGGCTCGCAGCGATACTGTCTTCTCGGCGCTGCGCCTCATGATTGT
CTTTTCGGTGCGTTCATCCCTTGCTTCTGGGCTCTCACGCTAATTTCGCTTACTAATCATGCGTTCAGATGTTCTTCCCC
GATCGCTACGAGGGAGACCGGACAGCCCGCGTCGTCGGCTGGAGGGAGCACAACCTCGGTGTGCTTGCACTGCTCCAGGC
CCGTGGACCAGAAGCCCACGTCATGGGAGACGGTCACCAAATGTTTGTCGACTGTCGTCTACCTCTAGTATGTCTCGCCC
GGAAGAGCCTTCCCCCCTTTCTTTGAGCAATGCTGACAACTAACCTTGCTCAGATCATCGCTGCTATTCGCAGCCGCAAG
AAGACGGTCCTCAACAGCCAGCCATGGATGACGATCCCGTGGCGGGAGATCCCCAAGACGCCCAAGGACCAGCTGATGGA
CATCATGGCGGGCATCCCCGGTGTCCTCGAGGACGTCGACGGGCTCGCCGGAGTCTGACCGAGAGCAAGGTCCGCGAGGC
GTCCCGCCGCAAGATTGTCAACGCTTGCTGGATTTATGACCGGCAATTGGTCCAGTGGTACGATGAAAACGTGCCGATTG
AGCGCATGCAGGCCCTTGAGAAGAGCAGGTCTGACGGCCCGGTGTCGACCGAGGACCTGTCCATCATCTACAGTATGATC
ACATTTTATACTGCCCGCTTGCTGCTATCCATTTCCATGCGCGTCCTCGCCGTCCCCGACCTGCCACCCCGCGCGAACCT
GGTCCTTTGCGTCCGCATGATCGGCCGCTACCTCCGCTACTTCTTCCACCCCAGCACCGGCCAGTACGGCCTCGAGATGA
TCGCCTTCCCGTTCGGCATCTGCCTCCAGACACTCTACTCCAACCCTCACAACACGGACAACTGTGAAGAGGAAAAGGCC
GTCTTCCGGGAGCTCGCCGAGACCGACCGTGGCCACGAGATCATGGAGTTTGTCGGCACCATGCTCAAGACCTTTCCTGT
ATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62