GenePrediction:GLEAN_627 Details

Name: GLEAN_627
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1067789..1073078 (+ strand)
Length: 5290
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1067789..1068728 (+ strand)
Length: 940
Type: CDS
Source: GLEAN
Position: GCSC_97:1069028..1069533 (+ strand)
Length: 506
Type: CDS
Source: GLEAN
Position: GCSC_97:1069610..1069738 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_97:1069794..1073078 (+ strand)
Length: 3285
>GLEAN_627 class=GenePrediction position=GCSC_97:1067789..1073078 (+ strand)
ATGGCTCGCAGACAGGACGATGTCATCGACCTCACGCGGAGCGATGATGAGTCTGAGGCCGGCCGCGCCGTCCACTCGCC
ACGGCAGCCGCCGCTGTCGCGTCTTCATGACCGCCCCTATCAACAACGGCACAGGTTTCCCAGCAGCTCGGACTCGCAGC
CGGCTCGCCATCTGGGTGGCAGCGCCCAGTACTCGGTGCCATCCACGCCGCTCTCGGGGGGGCACAGCGGCTACGGCGGC
CTGGGCTCTCTATTCAACAATGCCGCGAACAATTTTGGCTCCCTCATGGGTCTCTCCTCGTCCGGCTCAAGCGGCTTATC
CAGAGGGTCTGCACCTGCTAATCCGCCACCTCCGTCTCAGAGAGCGGGGAGGATGGAGAGGACAGAGCGACAGGAGACCC
TGTCTGCATCTACGTCCCTCCCAGACATGCGTGCACCCATGGCACCGTTTACCGCCTCACAATCGTCACCGTCGGCACGC
CATCGCTCCAGCTTTCAGCACCAGCAGCACCAGCAGTCATCGACCGGAGTGGCTTCTTCTTCGCAGTCGGAACAGCGTAT
GATCTGGCTCGCACCCCCTTCGTCGCCTAGTCGCGACTCGAGGTCAACGCCCATCGGTTCTGGCCACCCGCCATCACCTT
CTCAACATTTCTCTTCTCACCGGTTTGCTCCCACCTGGTCCTCGTACCAGGCCGCCTCTCAGCGCCCGCCTTTGCAGCGG
CAGAACTCGCAGCCTTACTTCAGTCAGCAGCCGTCCAGACAGATGGCACACCAGAACGCTTCTCATCAGCAGTCGGCCCC
CTCGCGTCGGTCCTCGTTCGGGCACTTCTCTGACAACAGGCCGTCCCCGCCTCTTCAGTCGGAGGCTTTCCAGCTACCCC
CCTATAAGCCTGGCCGAGCAAATGATCAGACGCTGCCTCCTCTCATCAGCTCCCCAAGACGTCACCATTTTGCGCAGCAT
CCGTCTGCAAATCGGAACTCTCACCTGGTGCCATCCCCGCTACATAGTCCAGATGGTCGTTCTTCTCGCCCTATGAATCA
TTTCCCGCAAGATTCTTTGCGAAATTCACCGCCTTCGCATTCGCCCCGTTTGCTTGCTGTTGCCGCTGCAGCTTCTGCCG
CAGTCGATTCGCTTCCAGAACCGTCTCCTGCCCTTCAGTATTCCCCACGTCCGGCAGCGGTGTCTGAGCCACGCTCAGAC
GAGCCGTCACATCGCCCTCACTCTCTGACACGAAAACAGTCCGAGCCATCTCCCCGCCGTCAATCGCCACCGAGACAACT
TCCTCTCACCAAACAATCACCATCGAAATCATCCTCATCGATTCGCTCTTCTTCGCCCAAAGGCTCTCCCCTACTGACAC
CAGCTCCACCCCAACCTCAAGCCGTGACTGTCCCGCATGCGTCAGCTCCCAGTCCGGCTGTACCGTTGAGATTGAGAACC
TCGGCGTCTCCATTACCGTCGTCAACTGTTCCATCGCCACCTCTCTCCTCTGTTCTCTCGTCCTCGCCGGTAACGCCTAC
TTCTGCAGCTTCGGCTCAGGCACCCGCTGTGCAAACCGACGTTGCCACAAGGGCTTTAACCCCTGCTCAGCCTATCTCAG
GTCGAGTGGTTGTCTCTCGCCCTCCCTCACCACACTCACCTTTGCCCAAGTCTCCGACGCTGGTATCGCCTACACGCTCT
TCCCCAGAGAAGGCCGCCTCACGGCCGAGTCCGCCACAGGCCATGACTCCGAAAGGAATCGACTGGTCTTCTGGCAAGAT
CGAAACAGCCCTCCTTGGCTTTGTGAAAGATCTGCATATCGACCATTCCCGCTATGTAAAGCACTGCATCGTCACCCAGA
AGCCGCGTGTTCGACAACATCTCAGCTCGTTTGACGACTTGGCGGAACTCCATCATCAGGTCGTGGATCCTTCAGCAGAT
GCGGAAGAGCCGCTAAAAGTTCGCATAAAAGTAAGACAACTACCACCTCGTTTCTTGGTTCCCAATTGCTCACAGTGTTA
TGTAGCTATACCGAGACAATCAGCGTCGGCCGGAAGGACGCGCGATGAATGTCCGGACCATTTCTTTGAAGACGCCCAAC
ACCAAGGTGCCAAAATACCGTTTTCACCATGTAGAGATTGCAAAGAACATCTTGTCTCCAAACACGCCGCTCAAGTTCAT
CCCCCATTTTAGAGATCTCGAGGATGGATCGGAGGATAAGAAGAAATTTGACCAGTGGATCGAAGAGCTGGAGAGCATGG
AGGTGAAGTCGGGCTTCGACACTTCCAAGCGTTTCGATAAGTGGGCTTCGACCCGCACATCCGAGTATGCAAAGGTTGTC
TCGATCTACCTAGAGAGGTGGATATCTAGCCTTGGAATCGATAATTGCAGCAAGACGACCCTGATCCGGTACATGGCCAG
CGAGCTGCAGAACGAGTCGTCCTTTACGCCCAAGCAGAAGAACAGCTTACTCAGCTCATGTGGTGAGAGTGCTGGAACGC
CACGGGCCACCATGGTTGCCAGCATGTTCACGGATGCATTCAACCGCGTGTTTGAGAAGAAGCACGTTTCGTTGTACGAC
GTTCTCCGGCAGGATGAAGCGTTTGAAAACATGATCGACCCGCGGAAAGCCACGAAAGACGCTGCGATAGCTGCAGCTGC
AGCAGCTGCCGCTTCCTCCGGTGGCACTGGAAGCAGCCTGGTCGGCCGGCTGGAGCAGGAGAAAGAAAACCACTTGGACC
AGATTCAGCAATATCTTGGCACGTACTCCATGCTCGGATGTATGATTTGCCATACACACTCGTGTGAGCATGGAGAGTTT
GACTTTGAGAACATCCGGCGCTGCTTCTCGATCGAGGACTGTGGAGGCAAGCTTTGGATGCATGTTGAGCAACGTCGCGA
GGCGCAAGCGAGGGCGCGGCTACAGCAGCATCAGCTCCAGCAGAAAGCCATTTCAAGCGGATCGGCTGCCAACGGCAGCG
AAATTCGTCTCAACAGTGCACTCCCGCCTCCTTGCGAGAACCAATGCTTTCGGAGCTACGATATTGGCGATCCTGCGTTT
GCTAATCGCGCATGGACGGAAAATGAGACGACGCTCTTGCGGAGCCTTCAATACACGCTTGCCGACAGCTCTGTCAATCT
GCAGTGCACTGCTGCGGCCCTGTTGGGCCGATTCTGCTGGGAGGTCTACCGGCAGATGAAGGAGCTGGGCATGCACACAG
CCCAACCGTATGCCCTTGCAGATCGGATCGTCGATCCACCGGCTGCAAAGCCGGTGAGCTGGTATGACCGCCACCGAAAA
GTGCTCAATGGCGACTGGTCGGACCACACGTACACGCACATCCACGCGCTCCGGGAGCAACGCGAGCCCTGCAACCACGA
CGGCCCTTGCACGGTGGTACGAGGATGTCCCTGTGCCGAGGCGAAGCTGCTCTGCGAGCGGTTCTGCCGCTGCACGTCGG
AGAAGTGCGCGTTCAAGTTCACGGGATGTGCGTGCCACGCGGCTGGAAAGACGTGCTATGCGCGGCAGAAGGAGGGCAAG
CCGTGCATCTGTGTGCAGCTGAACCGCGAGTGCGACCCGGTGTTGTGCGGTGGATGCGGATCCCGCGAGCGAGCGGATCC
GCGTAACCGAGACAACGACGCATTGCATGGGACGGGCTGCCAGAATGTCGCTCTCCAGCGTGGCAAGTCGAAGACGGTGC
TTCTAGGCAAGTCGCAGCTCGACGGCTGTGGCTACGGGCTGTTCACTGCGGAGGATATAAGCGCAGAGGAGTTCGTGATT
GAGTACATCGGCGAGCTGATTACGCACGACGAGGGAGTGCGCCGGGAGGCGCGTCGTGGCGATGTGTTTAACCAGGAGTC
CAATGCGTCGTATCTGTTCACGCTTCTGGAGCAGGACGGCATCTGGGTGGACGCGGCCATCTACGGAAATCTATCTCGGT
ACATCAACCACGCGTCCGAGCAGGACAAACGTGGCTGCAACATCACGCCCAAGATCCTCTACGTTAACGGCGAGTTCCGT
ATCCGGTTTGCGGCCATGCGCGACATCAAGGCCGGGGAGGAGCTGTTCTTCAACTATGGCGAGAACTTTCCCAACCTGAC
AAAGAAGCTTCTGGAGGACAAGGCCTCCGTCAACGACGAGGACGACTTGAGCATAGCCACGAAGTTGAACGGTACCGAAG
GTGGGCGAGGCCAGGGCGCCGCGAAGCGACGCAACCGCAAGACGCAGAACGCCGCCAAGGCCTCGCGGAACGGCAACGGA
CGGAACGGCAACAGCACGGTGAAGCGCGCAAAGGCCAAGGGGGCGCGGAAAGAGGCACCTCCAGCGCATGCGCAGGCCCA
TGTGGCCGAATCGGTGGACGAGATGGACGTGGATGACGACATAGCTGCGCAGCCGAAACGGGGGATGAAGCGCAAGCAGC
GGCATCATCTCTACGACGAGGATGACGAGATGGACGAGATGGACGATGAGGAGCACGAAACGGCGCCGGTCCGATATCAT
CGTCGGGGAGCACAGCAGCACGAGTCAGACGATGAGTTTCAGAACAGTCCTTCACGCCGGAGCTCGCGGACCAGACGTCG
ACGAGCGGCCACGACGACAGTGACGGCAGCTGCGACGACTACAACAACAACTACGACAGTTAGGACAGCAGCTGAGACAG
GAGCCGGATCGGCAACTGAGCCAGCAATCGGAATAACAGCGGTGGTGGCTGCCGGAAATGAGGGGACGAAGCGACGCAAG
GACCATCAGCCGGAACTTCCCAGTCGCCACGACGATCAGCACAACGACGCGGACGATGATGACGCCAACCACAGCGAGCG
GCTCCGCAGCGGCACCAGTCGTTTGAAGATGACAGGCGGTCGTGCTGGTGGGAGCGGAAATGCGAATGGGCATGCGAATG
GGCAAGCGCATGGAAGTGGCAGTGAGCCGCCACGGAAACGACCACGAACGGCGAATGGTGATGGCGATGCGACAGCGGTG
GATTCCGACGAGCCTCTTGTAGCGGGCACGCCACTACGAAAGCGCACTCGCCTTCATCCAGAGCACCAGCATGAGCACCA
GGAGCAGGAGCAGCATCTGCAGCATCATCTTCAACAGCAGCTAGAGCAGAGTGGTGGAGGTGGCACGGACGACGACCAGG
GCAGCATCATGTCGGCCAGCCAGTTTTACGGACAGCGAAACGGCGGCAGCACAAACGGCCATGGAGGACTGGTGGTGGCC
GACTCCGACGAGGAAGACGGCGAAGACTCGGTCGACCGGAGCCAGCGACGACGGCAGAAGCCGGCACGATACCGATCGGA
GGCGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62