GenePrediction:GLEAN_6281 Details

Name: GLEAN_6281
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1084488..1082298 (- strand)
Length: 2191
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1084488..1084446 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_144:1084365..1084243 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_144:1084157..1084046 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_144:1083968..1083893 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:1083698..1083543 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_144:1083491..1083040 (- strand)
Length: 452
Type: CDS
Source: GLEAN
Position: GCSC_144:1082970..1082298 (- strand)
Length: 673
>GLEAN_6281 class=GenePrediction position=GCSC_144:1084488..1082298 (- strand)
ATGGGCAACGGCCAAGGAAAACTCTCCGATGTCACCGGCGAAGGTGAGAATGCTGGAGGTGTCGGGTGCATGAGAGGCAT
ATACGACGCGGAAACATGGGCTAACGTGGCTTGGAACTGGCAGTAAATTTGAATCACTTCCGCCTTCTCCGGGTCGTCGG
TCGCGGTGCCTTCGGCAAGGTACGCATCGTCGAGCGGAAAGACACCGGACTTTCCTTTGCTCTAAAGTATATACGGAAAG
ATGAAGGTGCGGCCAAGTCCTAGATATGAAAGAACGGTGGCACGATAATGGGCAGACAGGCCAGAAGCTGACGCCGCTCC
TCGTTTTATAGTCGTTCGCTCAGAAAGCGTCCGGAACATCATCCGTGAGCGTCGTATGCTCGAGCATGTGAACCACCCCT
TCATCTGCAACCTGCGGTACAGCTTCCAGGACATTGAGTACATGTGCGTGCCAAAAATGCCAAAACTCCCACCCAGCAGC
TTCTGCGTTCCTTGACAGACAACTGACAGGCAGCGACCAGGTATCTTGTTGTCGATCTCATGAGCGGCGGCGACTTGCGT
TTCCATATTTCCCGAAAGACCTTTACCGAGGATGCTGTGCGCTTTTGGATCGCCGAGCTGGGTTGCGCTCTGCGTTATGT
CCACCGCCAGGGCATCATCCACCGCGACGTCAAGCCGGACAACGTTCTCCTCGATGCTGACGGCCATGTCCACCTTACCG
ACTTTGTACGCCAGTCCCTCAAGCTGTGTCCCTAGGGCCTTCTCTCTACCGTACTGACACTATACTCCAGAATGTTGCGT
CCGACATTGTTCCTGGCCGGGTGATGACCAGCAAGTCCGGTACTCTCGCCTATCTTGCTCCAGAAGTGTACTCTGGACGT
GGATACGACATCCGTGCCGACTGGTGGTCACTAGGCGTCTTGTTCTACGAGTGCATTTACAACAAGGTAAGTCTGGCCAG
TCCCTAGCAACGGCGAACGGGTCCTTACTCTTCTTAGCGCCCGTTCGAAGGCACCTCTGAATCGTCACTGGGCAATGTTG
TTCAAGCCGCCAATCCCAGATTTCCCATTACTTCGCCACCTGTCACCCTTCCCTGCCTCTATGCCATACGAAGTGCCCTG
AGTCTGGACCCGTCCAATCGCCTCGGCAATACTTGGGATAGTTTTATATACCATGATTTTTTTGCCATGATCGACTTCGA
GGCTTTGGAACGAAAGGAAATCGAGCCTGTCTTCATCCCGTCGGCTGACAAGACGAACTTCGATGCGACATACGACCTGG
AGGAATTGCTCTTGGAGGAGGCACCTTTGGAGGCCCGTGCCCGTCGCCAGAAGCCGCGCGAGCGCCTAAAAGACGATGCC
ACCGATAAGGAGATCCGAGAGGACGAGCTGTACCGCATGATTGATCGAGACTTCCGGCCATTTGACTACACTGTGGCCGC
TTACAAGAAGTAGGCACTTCTGCTCTCTAGTCGTCTTTCCTCGCTTGATGTAACTCGACTAACCCCATCCTTCTGCAGGT
TGACTGAACAGGCGGCGGCACAGCAGAACGGTCAGCAGAACGGCCCATTCGCCGGAAATGGGTCTTCTGCATCCACGCCG
CAACCGCAAGCCATCACGACCGACCAAGCGTTGCCAGCGACTCGGATCGGCGGGATCGCAGATGGAGACACCTCGGGTGC
GAGTGTCGCCTCGACATCCCCGCCGATCAGATCAGGGGCTGATCGTGATGGCCAGTCCATCAGCAGCCAGCAGCCGCGAC
GACAGCCGGGTGCTCCGCCAGGACGCCCGCCTCCAGTGCCGCCACCGCTTGCACCCTACGCAAATCCATACACGAACTCG
GCTCGCAACAGCAACTACCGCCCCCTACGCAATCTGGGCTCCGTCTCTGTGCCAAACGGCAGCGTCGTCCTAGGCAGCCC
GACAGGCGGCGTGCAGGTCCGCTTAGATGGGCACAACACCGTTGGTAGCTCCTGGTCGGAGTTGGCCCGGCAGGATGCGA
CACTTCCCACCGATGCCGCGGCCGGCGGCCTGCTAGGTGTCGATGATGGTAGCGGGGGCAAAGCTGATGGAAGCTCCAGC
AGCGGCGGCGTGTTCGGATTTTTGAGCCGCAAGAAGGGCCGTGGGAATAGCCCCAAGCCAAAAGAGCGCGGCGTACTGGG
CAAGGAGGGAGCCCGCGTGGTGATTGGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62